1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
worty [1.4K]
3 years ago
8

What is the coefficient for O2 in the balanced version of the following chemical equation: C2H4+O2→CO2+H2O

Chemistry
1 answer:
andriy [413]3 years ago
6 0

Answer:

3

Explanation:

Here's the balanced equation;

C2H4 + 3O2 → 2CO2 + 2H2O

C ⇒2                          C ⇒1 x 2 = 2

H ⇒4                          H ⇒2 x 2 = 4

O ⇒3 x 2 = 6             O ⇒ (2 x 2) + (2 x 1) = 6

You might be interested in
why is nitrous oxide sedation especially useful for control of soft tissue discomfort during dental hygiene procedure
Stolb23 [73]

Answer:

Because it has a quickly sedative effect and it has antimicrobial effect.

Explanation:

This gas is useful because is used to trait pain, reduce anxiety and promote relaxation, slow down the body reaction, so the dentist can use it to calm down the patients.

If the patient present some injuries, this gas can help in wound healing.

7 0
3 years ago
How many grams of carbon are in 0.24 moles of carbon?
Ronch [10]

Answer:

I'm converting this if I could remember how

2.882568

2 110321/ 125000

T-T sorry if I'm wrong I have bad memory

so I recommend not using my answer at all,

if that is even how y'all write it.

4 0
3 years ago
True or false: properties help us identify matter
sdas [7]

true.

Hope this helps!

3 0
3 years ago
Read 2 more answers
890J of heat are applied to a piece of aluminum, causing a 4.6°C increase in its temperature. The specific heat of aluminum is 0
Semmy [17]

Answer:

The answer would be C 214g

Explanation:

890j of heat causes 4.6°c increase in temperature

specific heat of aluminium after is o.9022 j /g°c

now by using the formula .The mass of aluminium would be c that is 214 g

7 0
3 years ago
What is diffusion ,?? ​
UNO [17]
Diffusion is a process that results from the random motion of molecules and results in a net movement of matter from a high-concentration region to a low-concentration zone.
4 0
2 years ago
Read 2 more answers
Other questions:
  • Which rock would be the best source of the mineral garnet?
    12·2 answers
  • By what factor does [h+ ] change for each ph change? (a) 3.20 units
    15·1 answer
  • Help please I don’t know the answer
    14·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • If 75.2 grams of Calcium Sulfate are reacted with an unlimited amount of Sodium Phosphate,
    9·1 answer
  • Which buffer system is found in the human body?
    15·1 answer
  • What is the answer pllleeaasseeeee?????
    5·1 answer
  • Inner planets usually have...
    10·1 answer
  • What is the mass of carbon in 290 g of CO2?
    6·1 answer
  • What are the consequences of building a equitable water sanitation
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!