1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
2 years ago
10

What is the only force that can act on an object in free fall?

Chemistry
1 answer:
kkurt [141]2 years ago
8 0
I’m going to say Gravity.
You might be interested in
For each pair of ions, choose the one that has the smaller radius.  Na+ or Mg2+  Cl- or K+
Drupady [299]
Mg2+...because it loses 2 electron which is on its valence shell making it empty and making it have jst 2 shells. The radius calculated from d nucleus to the new valence shell is then smaller than that of Cl^- and k+
4 0
3 years ago
How many grams of Sg is required to produce 83.10 g SF6? S: +24F-->8SF
ozzi

Answer : The mass of S_8 required is 18.238 grams.

Explanation : Given,

Mass of SF_6 = 83.10 g

Molar mass of SF_6 = 146 g/mole

Molar mass of S_8 = 256.52 g/mole

The balanced chemical reaction is,

S_8+24F_2\rightarrow 8SF_6

First we have to determine the moles of SF_6.

\text{Moles of }SF_6=\frac{\text{Mass of }SF_6}{\text{Molar mass of }SF_6}=\frac{83.10g}{146g/mole}=0.569moles

Now we have to determine the moles of S_8.

From the balanced chemical reaction we conclude that,

As, 8 moles of SF_6 produced from 1 mole of S_8

So, 0.569 moles of SF_6 produced from \frac{0.569}{8}=0.0711 mole of S_8

Now we have to determine the mass of S_8.

\text{Mass of }S_8=\text{Moles of }S_8\times \text{Molar mass of }S_8

\text{Mass of }S_8=(0.0711mole)\times (256.52g/mole)=18.238g

Therefore, the mass of S_8 required is 18.238 grams.

7 0
3 years ago
What is the molecular weight of bromoform if 2.50X10^-2 mol weighs 6.33 g
babymother [125]
Jwwnsnsnxjxjdnsmzmmxzmzm
8 0
3 years ago
Automobile bodies contain significant amounts of iron. The iron is protected by the addition of zinc. This is called galvanizati
Oksana_A [137]

<u>Answer:</u> The balanced chemical equation is written below.

<u>Explanation:</u>

Galvanization is defined as the process in which a protective layer of zinc is applied to iron or steel to prevent the metal from rusting.

Zinc prevents the oxidation of iron and acts as a reducing agent in the process.

The half reaction for the process follows:

<u>Oxidation half reaction:</u>  Zn\rightarrow Zn^{2+}+2e^-

<u>Reduction half reaction:</u>  Fe^{2+}+2e^-\rightarrow Fe

Net chemical equation:  Zn+Fe^{2+}\rightarrow Zn^{2+}+Fe

Hence, the balanced chemical equation is written above.

6 0
3 years ago
What was the name for the secret code used by many alchemists?
ahrayia [7]

Answer:

A. Zodiac

B. Palingenesis

C. Palabra mysteria

D. Decknamen

The correct answer is D. Decknamen.

Explanation:

5 0
2 years ago
Other questions:
  • Calculate the density of an object that has a mass of 43 g and a volume of 56.0 ml.
    5·1 answer
  • The Lewis structures of four compounds are given. In the first molecule sufur is the central atom. There are two oxygen atoms bo
    11·1 answer
  • Explain why isotopes of the same element behave differently in nuclear reactions but not in chemical reactions
    15·2 answers
  • Rachel is using a Bunsen burner to heat a solution. Which of the following would let her control the rate of reaction in the sol
    15·2 answers
  • Please help me...thank you so much..
    6·1 answer
  • Write 2.0 x 10^-3 in standard notation.
    6·2 answers
  • True or false. for all atoms of the same element the 4s orbital is larger than the 3s orbital
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of the following is an example of a change from gravitational potential
    11·2 answers
  • Please help! Fill the blank
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!