1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
2 years ago
13

What happens to carbon in plants when the plants die.

Chemistry
1 answer:
Korvikt [17]2 years ago
4 0

Answer:

Released into the atmosphere

Explanation:

The carbon that the plant had been storing when it was alive, would be released upon death into the soil

You might be interested in
Give an example of how you could use different reference frames for the same motion.
RUDIKE [14]

Answer:

Motion is defined as a change of position. How we perceive motion depends on our frame of reference. Frame of reference refers to something that is not moving with respect to an observer that can be used to detect motion.

Explanation:

8 0
3 years ago
Read 2 more answers
At a certain temperature Kc = 9.0 for the equilibrium 24() ⇔ 22(). What is
Iteru [2.4K]

Answer:

.

Explanation:

.

5 0
3 years ago
Define by-products of petroleum?
lara31 [8.8K]
Petroleum products<span> are materials derived from crude oil</span><span> as it is processed.

Hope this helps! </span>
7 0
3 years ago
Heat and pressure deep beneath earths surface can change any rock into what?
Alik [6]

Answer:

Metamorphic

Explanation:

Because it describes as a rock framed from other rocks by the action of heat and pressure.

5 0
3 years ago
What will happen when the rates of evaporation and condensation are equal​
Ilia_Sergeevich [38]
A random person put the answer for you
6 0
3 years ago
Other questions:
  • Hydrogen bonds between water molecules are responsible for the unique chemical and physical properties of water. True False
    6·1 answer
  • A compound is found to contain 11.21 % hydrogen and 88.79 % oxygen by mass. What is the empirical formula for this compound?
    6·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • PLEASE HELP WILL GIVE BRAINIEST
    13·1 answer
  • A compound contains 38.7% K, 13.9% N, and 47.4% O by mass. What is the empirical formula of the compound?
    5·1 answer
  • What is the word equation of 1 H2 + 1 Cl2 → 2 HCI
    8·1 answer
  • Helpppppp!!!!! It’s due today <br> URGENT!!!!!
    9·1 answer
  • Which is better disney plus or hulu​
    12·1 answer
  • copper hydroxide and potassium sulfate are produced when potassium hydroxide reacts with copper sulfate balanced equation
    12·1 answer
  • Write balanced nuclear equations for the following:(b) Alpha decay of polonium-218
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!