1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
10

Bob has brown hair and Sally has blonde hair. If brown hair is dominant and blonde hair is recessive, is it possible for Bob and

Sally to have a blonde-haired child? Use the GENOTYPE of each parent to EXPLAIN your answer.
Biology
2 answers:
Fynjy0 [20]3 years ago
8 0
Yes it is, let’s say B - is for brown hair and b - is for blonde hair
to have blonde hair they would have to have a bb genotype meaning that if bob had the Bb genotype then sally and bob have a 1/4th chance of having a blonde haired child
Dominik [7]3 years ago
3 0

Answer:

no it is not possible

Explanation:

bc when you do a punnett square brown hair is dominant so there is not a possible way for their child to have blonde.

You might be interested in
What is the answer and give me an explanation??!?!?!
brilliants [131]

Answer:

beryllium (Be). Beryllium metal is relatively unreactive at room temperature, particularly in its massive form.

Explanation:

8 0
3 years ago
An organism is made up of A group of tissues working together. A group of cells working together. A group of organ systems worki
lidiya [134]
A group of organ systems working together is an organism.
3 0
3 years ago
The trophic level which includes the greatest amount of available energy is made up of
ioda

Answer:

z

Explanation:

3 0
3 years ago
The diagram below represents a structure found in most cells.
bekas [8.4K]
B. Part of a gene for a particular trait

I think!!
6 0
3 years ago
Where is the adenine the thymine and cytosine located in DNA
Juliette [100K]

Answer: ​Adenine (A) is one of four chemical bases in DNA, with the other three being cytosine (C), guanine (G), and thymine (T). Within the DNA molecule, adenine bases located on one strand form chemical bonds with thymine bases on the opposite strand.

4 0
3 years ago
Other questions:
  • Opsonization, the process in which some pathogens are coated with antibodies and complement proteins, is representative of which
    9·1 answer
  • How does insulation keep building cool in the summer?​
    5·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • If Susan and Henry continued to have children they would always have type B blood. What are Susan and Henry's genotypes
    15·1 answer
  • What happens to the energy in the bonds in glucose?
    10·2 answers
  • . In which phase of cellular respiration is glucose a substrate?​
    8·1 answer
  • What effect do keystone species have on an ecOsystem?
    10·1 answer
  • Which staternent is one of the three parts of cell theory
    7·1 answer
  • 1. What is the largest marine mammal living in Earth's Oceans?
    10·2 answers
  • Please help i'm stuck on this and it's due soon, questions are in the images, will give brainliest!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!