1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korolek [52]
2 years ago
6

Which of the following phylogenetic trees best represents this data?

Biology
1 answer:
Bess [88]2 years ago
3 0

Phylogenetic trees are tree-like graphic representation that show the evolutive relationship between different taxa.

<h3>What is a phylogenetic tree?</h3>

A phylogenetic tree is a graphic representation of the evolutive relationship between different taxa.

This representation has a tree-like shape.

The phylogenetic tree expresses how far or close are in evolutive history the different groups.  

<h3>Structure of the phylogenetic tree</h3>

The phylogenetic tree is composed of,

  • Lineages → The taxonomic groups of interest. These are placed in the extremes of the branches.

  • Nodes → These are the ramification points, which are also known as divergence points. They represent the location of the most recent common ancestor.  

  • Root → This is the oldest common ancestor that all lineages share. The first one in the tree.  

⇒ Highly related groups that share a recent common ancestor. This means that they all diverge from the same node.

⇒ Lineages less related to each other are those whose common ancestor is far away in history.  

In a phylogenetic tree, the most distant group receives the name of outgroup.

It shares no traits or characters with the lineages of interest that compose the ingroup.

You can compare the outgroup with the ingroup to determine the evolutive relationship and which characters are primitive or derived.    

Since I do not have further information, I will describe each of the trees.

A) Capibara and camel share a more recent common ancestor in history than they do with guinea pig. Capibara y camel are more closely related.

B) Guinea pig and Capibara share a more recent common ancestor in history than they do with camel. Capibara y guinea pig are more closely related.

C) The three lineages have the same common ancestor and are equally related to each other.

D) Guinea pig and Camel share a more recent common ancestor in history than they do with capibara. Camel y guinea pig are more closely related.

According to your information, you can determine which tree is the best.

You can learn more about phylogenetic trees at

brainly.com/question/8188690

brainly.com/question/2189834

You might be interested in
Which of the following describes what might happen if the septum in the heart ruptured? (2 points)
Hoochie [10]

option c is the answer

Explanation:

septum is present between the two ventricles and separates the oxygenated and deoxygenated blood. hence if it gets ruptured then the two blood will mix up. thanks

8 0
4 years ago
Examine the words and/or phrases below and determine the relationship
gizmo_the_mogwai [7]
Natural gas

explanation:
solar power, coal, and petroleum are used to power things (i.e. produce electricity)
3 0
3 years ago
You will answer: what is the relationship between Force and Acceleration?
77julia77 [94]

Answer:

Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49Log

04/12/2022

myurelschool asked a question10:49

Explanation:

4 0
2 years ago
Piper accidentally cuts her finger while chopping vegetables. Why does she feel pain? The nerves can’t transmit an action potent
Pie
I would go with B) Nerves in the finger detect stimuli and send the message to the brain.
3 0
4 years ago
Protists that play an important role in aquatic food webs are called
Sergeu [11.5K]
Plant like Protists - also called algae - autotrophs 
<span>Fungus like Protists - heterotrophs, decomposers, external digestion </span>

<span>From the above their role in the aquatic food chain is clear . </span>

<span>They perform their role as </span>
<span>1) producers = example = Plant like Protists - also called algae - autotrophs </span>

<span>2 ) consumers = example =Animal like Protists - also called protozoa (means "first animal") - heterotrophs </span>
<span>and </span>
<span>3) Decomosers = example ==Fungus like Protists - heterotrophs, decomposers, external digestion

</span>
3 0
3 years ago
Other questions:
  • Acid rain only happens in the summer.<br><br> True<br> False
    6·1 answer
  • Which atmospheric conditions would cause the greatest rate of evaporation from a lake?
    7·2 answers
  • How muscle cells structure determines its function in a body
    10·1 answer
  • WWhich of the following genotypes represents a homozygous dominant trait?
    9·2 answers
  • Assume that in cattle a spotted coat is dominant to an even coat, short horns are dominant to long horns, and the traits for coa
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • WHAT IS THE SEQUENCE OF A-T-G-G-C-A,
    14·1 answer
  • Explain how gene therapy could provide a cure for genetically inherited diseases
    13·2 answers
  • Take points <br>extra 50 points ​
    5·2 answers
  • 3. Look at the rock cycle.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!