1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
3 years ago
12

Recalling the Importance of Geographic Isolation

Biology
1 answer:
finlep [7]3 years ago
7 0

Answer:

1a 2b 3c 4d

Explanation:

it goes around

You might be interested in
Difference between Squamous epithelium and Stratified epithelium. (Pls answer quick) ​
Simora [160]

Answer:

squamous epithelium consists of a single layer of flat cells. It is found in lungs,heart and blood vessels.It allows the movement of materials across it.

stratified epithelium has many layer of flat cells.It is present in lining of oesophagus and mouth and also over the skin

8 0
4 years ago
Read 2 more answers
What level of protein should a basketball player in the off-season trying to gain muscle mass consume
nata0808 [166]

Answer: 2.5-3.o grams per body weight

Explanation:

5 0
2 years ago
An atom of element A has 49 protons. What would the element's atomic number be?
kirill [66]
The atomic number is 49.

The atomic number is the same as the number of protons. So if there are 49 protons, then the atomic number of element A is 49.
5 0
4 years ago
Read 2 more answers
In cells hydrogen peroxide is converted to water and oxygen throughout the activity of
diamong [38]
A. Enzymes, We have an enzyme in the cells in our bodies where hydrogen peroxide is converted.
8 0
3 years ago
True or False:<br> "Browns" help compost by leaving air<br> pockets.
Alina [70]

Answer: True

Explanation: It helps to create good air flow and provides essential oxygen for microorganisms.

4 0
3 years ago
Other questions:
  • Two uses of resources​
    12·1 answer
  • The wings of swallows and dragonflies perform the same function: they enable the organisms to fly. Based on these images, what i
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Approximately __________ percent of adolescents and young adults have engaged in at least one nonsuicidal self-injury behavior,
    15·1 answer
  • The dates shown in the diagram above refer to the ages of __________
    15·2 answers
  • Which of the following was NOT a recognized kingdom in Linnaeus' early classification system?
    13·1 answer
  • Silicon dioxide (SiO2) and aluminum oxide (Al2O3) are the two most abundant compounds in the _______.
    7·1 answer
  • PLEASE HELP!!!! 1OO POINTS!!
    10·2 answers
  • How do endocrine hormones reach their target cells?.
    12·1 answer
  • _____ is on the shoulders of the police and investigation team.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!