1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
3 years ago
5

If 0.15 mol of I2 vapor can effuses through an opening in a heated vessel in 36 sec, how long will it take 0.15 mol of Cl2 to ef

fuse under the same conditions?
Chemistry
1 answer:
marysya [2.9K]3 years ago
6 0

<u>Answer:</u> The amount of time required by chlorine gas to effuse is 19 seconds.

<u>Explanation:</u>

Rate of a gas is defined as the amount of gas displaced in a given amount of time.

\text{Rate}=\frac{n}{t}

To calculate the rate of diffusion of gas, we use Graham's Law.

This law states that the rate of effusion or diffusion of gas is inversely proportional to the square root of the molar mass of the gas. The equation given by this law follows the equation:

\text{Rate of effusion}\propto \frac{1}{\sqrt{\text{Molar mass of the gas}}}

So,

\left(\frac{\frac{n_{Cl_2}}{t_{Cl_2}}}{\frac{n_{I_2}}{t_{I_2}}}\right)=\sqrt{\frac{M_{I_2}}{M_{Cl_2}}}

We are given:

Moles of iodine gas = 0.15 moles

Moles of chlorine gas = 0.15 moles

Time taken by iodine gas = 36 seconds

Molar mass of iodine gas = 254 g/mol

Molar mass of chlorine gas = 71 g/mol

Putting values in above equation, we get:

\left(\frac{\frac{0.15}{t_{Cl_2}}}{\frac{0.15}{36}}\right)=\sqrt{\frac{254}{71}}\\\\\frac{0.15}{t_{Cl_2}}\times \frac{36}{0.15}=1.89\\\\t=19s

Hence, the amount of time required by chlorine gas to effuse is 19 seconds.

You might be interested in
Which models of the atom does the experimental evidence from Bohr's hydrogen experiment support? Explain why these models are co
STALIN [3.7K]

Answer:

Rutherfords

Explanation:

The model of the atom supported by Bohr's hydrogen experiment is the Rutherford's model of the atom.

Rutherford through his experiment on gold foil suggested the atomic model of the atom. The model posits that an atom has a small positively charged center(nucleus) where nearly all the mass is concentrated.

  • Surrounding the nucleus is the large space containing electrons.
  • In the Bohr's model of the atom, he suggested that the extranuclear space of the atom is made up of electrons in specific spherical orbits around the nucleus.
8 0
3 years ago
Doing Science plz help
Murljashka [212]

Answer:

My guess is b or c but its robably wrong

Explanation:

I just also need points sorry <3

4 0
3 years ago
Read 2 more answers
Write the ground-state electron configuration for the chloride ion.You may write either the full or condensed electron configura
dalvyx [7]

Answer:

1s^22s^22p^63s^23p^6

Explanation:

Chlorine is the element of group 17 and third period. The atomic number of chlorine is 17 and the symbol of the element is Cl.

The electronic configuration of the element chlorine is:-

1s^22s^22p^63s^23p^5

Chloride ion is formed when chlorine atom gain one more electron. So, the ground-state electron configuration for the chloride ion is:-

1s^22s^22p^63s^23p^6

8 0
3 years ago
Which lists the structures, in correct order, through which light passes when it enters the eye?
Mashutka [201]

Answer:

cornea, pupil, lens, vitreous humor

8 0
3 years ago
Name the separation technique which could be used to separate mud and water without heating​
Westkost [7]

Answer:

Decantation

Explanation:

Decantation is a process to separate

mixtures by removing a liquid layer that

is free of a precipitate, or the solids

deposited from a solution. The purpose

may be to obtain a decant (liquid free

from particulates) or to recover the

precipitate.

Decantation relies on gravity to pull

precipitate out of the solution, so there is

always some loss of product, either from

the precipitate not fully falling out of the

solution or from liquid remaining when

separating it from the solid portion.

The Decanter

A piece of glassware called a decanter is

used to perform decantation. There are

several decanter designs. A simple

version is a wine decanter, which has a

wide body and a narrow neck. When

wine is poured, solids stay in the base of

the decanter.

In the case of wine, the solid is usually

potassium bitartrate crystals. For

chemistry separations, a decanter may

have a stopcock or valve to drain the

precipitate or dense liquid, or it may

have a partition to separate fractions.

Use of Alum and filtration process can also be administered for further purification

8 0
3 years ago
Other questions:
  • What happens to acetone molecules when you add heat to a beaker of liquid acetone?
    10·1 answer
  • Which reaction takes place in a nuclear fission reactor
    9·2 answers
  • Which three quantum numbers are associated with the 4d orbital?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Members of which group easily lose an electron to form a +1 cation?
    15·1 answer
  • In the reaction 4Al+_O2→2Al2O3 , what coefficient should be placed in front of the o2 to balance the reaction?​
    12·2 answers
  • 'if 100 grams of pure water taken from different sources is decomposed by passing electricity,11grams of hydrogen and 89 grams o
    11·1 answer
  • What is a plateau and how can one form?
    13·2 answers
  • Protons Ha and Hb in the compound given are _________. homotopic enantiotopic diastereotopic mesotopic none of these
    12·1 answer
  • Consider the hypothetical atom x. if the molecular formula for calcium nitrate is ca(no3)2 and the formula of x chloride is xcl2
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!