1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
14

Question 2 of 19

Chemistry
1 answer:
Alborosie3 years ago
3 0

Answer:

D

Explanation:

The temperature increases

You might be interested in
Why are halogens so reactive?
TEA [102]
<span>This means that has great capacity to react with other chemical elements in nature, reacting mainly with sodium, therefore, can only be findings in chemical compounds in most cases. 

hope this helps!.</span>
3 0
3 years ago
Read 2 more answers
May someone assist, please...? I don't know how to do chemistry work...
EastWind [94]

Answer:

1) 90.0 mL

2) 11.25 M

3) 0.477 M

4) 144 mL

Explanation:

The main formula that will be used for all these calculations is:

                                                     C₁V₁ = C₂V₂

C stands for concentration and V stands for volume and the subscripts 1 and 2 indicate an initial concentration or volume and a final concentration or volume.

For each problem, it's best to start by figuring out what you have and what you need to find. Figure out if you're looking for an initial value or a final value.

1) We need to find the initial volume. So, take what values you have and plug them in and then solve for whatever variable:

5.00 M · V₁ = 500.0mL · 0.900 M                        - divide by 5.00

C₁ = 90.0 mL

2) This time we're finding the initial concentration:

20.0mL · C₁ = 150.0mL · 1.50 M                          - divide by 20.0mL

C₂ = 11.25 M

3) Now we're finding the final concentration:

12.00mL · 3.50 M = 88.0mL · C₂                         - divide by 88.0mL

C₂ = 0.477 M

4) Finally, we're looking for the final volume:

9.0mL · 8.0 M = 0.50 M · V₂                                - divide by 0.50 M

V₂ = 144mL

6 0
3 years ago
The substance oxidized causes the other substance to be reduced and is called the:.
blsea [12.9K]

Answer:hydrogen Peroxide

Explanation:

4 0
3 years ago
Read 2 more answers
Identify the single displacement reaction. 2H 2 + O 2 ⟶ 2H 2O Al 2S 3 ⟶ 2Al + 3S Cl 2 + 2KBr ⟶ 2KCl + Br 2 C 4H 12 + 7O 2 ⟶ 6H 2
ozzi

Answer: Cl_2+2KBr\rightarrow 2KCl+Br_2

Explanation:

A single displacement reaction is one in which a more reactive element displaces a less reactive element from its salt solution. Thus one element should be different from another element.

Cl_2+2KBr\rightarrow 2KCl+Br_2

Synthesis reaction is defined as the reaction where substances combine in their elemental state to form a single compound.2H_2+O_2\rightarrow 2H_2O

Decomposition reaction is defined as the reaction where a single substance breaks down into two or more simpler substances.

Al_2S_3\rightarrow 2Al+3S

Combustion is a type of chemical reaction in which hydrocarbons burn in the presence of oxygen to form carbon dioxide and water along with heat.

C_4H_{12}+7O_2\rightarrow 6H_2O+4CO_2

6 0
3 years ago
Which best represents the reaction of calcium and zinc carbonate (ZnCO3) to form calcium carbonate (CaCO3) and zinc? Ca → ZnCO3
artcher [175]
Ca + ZnCO3 → CaCO3 + Zn
3 0
3 years ago
Read 2 more answers
Other questions:
  • The study of how humans impact the environment is<br> ?
    12·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Give the characteristic of a first order reaction having only one reactant.a. The rate of the reaction is not proportional to th
    15·1 answer
  • Jewelry is commonly weighed in carats. five carats are equivalent to one gram. how many grams of gold are contained in a 24-cara
    13·1 answer
  • Show work 261 nm to millimeters
    14·1 answer
  • The core of the pyruvate dehydrogenase complex is made up of eight catalytic________that make up the_______component.
    8·1 answer
  • When solid water changes directly to water vapor without first becoming a liquid, the process is called?
    14·1 answer
  • Which of the following is NOT a feature found on the Moon?
    15·1 answer
  • According to Le
    14·2 answers
  • Why is it necessary to mix any solution that does not show an immediate change?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!