1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elina [12.6K]
3 years ago
9

What is a characteristic of aging and the immune system?

Biology
1 answer:
elena-s [515]3 years ago
8 0
<span>The answer is, C. Antibiotics are often ineffective in treating older people who have deficient immune systems


(:
</span>
You might be interested in
HELP I WILL GIVE BRAINLIEST
jek_recluse [69]

Explanation:

members of the same species battle each other to protect their young

5 0
3 years ago
Read 2 more answers
3 What is the range of the function shown
jasenka [17]

Answer:

its like a quadrant.

Explanation:q4 ,same thing but negative.

6 0
3 years ago
HELP PLEASE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!<br> What kind of signals occur in the brain?
marin [14]

Answer:

there are all kinds of signals occur in the brain

Explanation:

Hope this help not sure if it is the right answer

5 0
3 years ago
Read 2 more answers
The majority of the protein inside a red blood cell (erythrocyte) is:
gladu [14]

Answer: Hemoglobin

Explanation: Hemoglobin is a protein very rich in iron found in red blood cells and is responsible for the transportation of Oxygen from the lungs to the whole body. Oxygen binds to the hemoglobin in red blood cells and the red pigmentation of blood that is highly oxygenated is due to the hemoglobin content found in RBC's.

4 0
3 years ago
Wernicke's area is associated with a. reflex centers for controlling heartbeat. b. sexual arousal. c. the ability to ride a bike
olga2289 [7]
E- the ability to speak
3 0
3 years ago
Other questions:
  • I need help I don’t know how to arrange them right what’s the answer? I couldn’t fit all the boxes but the second to last one sa
    12·1 answer
  • A fossil of a burrow left by an organism would be an example of what type of fossil?
    9·2 answers
  • You know that the narrow-sense heritability of milk production in Ayrshire cattle is 0.587. You perform an experiment where you
    13·1 answer
  • Immediately following the arrival of the stimulus at the axon terminal of a motor neuron there is a short period called the ____
    5·1 answer
  • 2. The mass of the nucleus is closest to A. 99% of that in the entire atom B. 1% of that in the atom C. 10–5 of that in the atom
    10·1 answer
  • Which of these is the best method to protect ourselves from the sun while going outdoors on a sunny day?
    12·2 answers
  • What is the length of a 0.2-mm object expressed in je m?
    6·1 answer
  • EXPLAIN WHY CELL DIVISION IS AN IMPORTANT PROCESS FOR MULTICELLULAR ORGANISMS.
    14·1 answer
  • As a scientist employed by the FDA, you've been asked to sit on a panel to evaluate a pharmaceutical company's application for a
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!