1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
1 year ago
8

How many oxygens are used per glucose molecule in glycolysis?

Chemistry
1 answer:
dimulka [17.4K]1 year ago
7 0

Answer:

0

Explanation:

You might be interested in
Equilateral triangle<br> What’s the answer
sesenic [268]
No answer choice??!????????????
3 0
3 years ago
Read 2 more answers
Match the natural resources to their uses.<br> water<br> forests<br> wetlands<br> parks
spin [16.1K]

Answer:

water - to drink

forests - to go camping and to get lost

wetlands - to see some rare wildlife

parks - to play

8 0
3 years ago
Read 2 more answers
HELP QUICK ILL GIVE YOU BRAINLIEST AND 25 POINTS! bromine (br) has four energy levels. name 2 other elements that would have fou
Temka [501]

Answer:

titanium and potassium

Explanation:

6 0
3 years ago
Read 2 more answers
The method by which the substances in a mixture are separated is called what?
yanalaym [24]

Answer:

Filtration is a separation method used to separate out pure substances in mixtures comprised of particles some of which are large enough in size to be captured with a porous material.

8 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Other questions:
  • Matt's cube, after 5 trials, had an average density of 7.40 g/cm3 . His group's cube was made of
    11·2 answers
  • At 66.0 ∘c , what is the maximum value of the reaction quotient, q, needed to produce a non-negative e value for the reaction so
    15·1 answer
  • Which of the following pathogens is one of the exceptions to the rule of typical cell structure? a. Bacteria c. Fungus b. Viruse
    5·1 answer
  • A solution is made by adding 50 grams of gelatin to 400 grams of water. What is the mass % of water in the sample?
    12·1 answer
  • 11. Is the following sentence true or false? Geologists have identified about 300<br>minerals. *​
    6·1 answer
  • An someone help i need the structure of 3,3-dimethylpentane?
    10·1 answer
  • Why is it difficult to dispose of the waste rock
    12·1 answer
  • If a very complex closed system has 200 J of energy in it, then the energy converts from 1 form to another to another to another
    15·1 answer
  • How many elements are in this chemical formula? <br> 2(NH4)2SO4
    7·1 answer
  • The half-life of carbon-14 is approximately 5700 years. An archaeologist unearths a piece of wood that is determined to
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!