1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
6

Which of the subatomic particles is responsible for the chemical behavior of a given atom?

Chemistry
1 answer:
tatuchka [14]3 years ago
4 0
The electrons determine chemical behavior
You might be interested in
Determine the number of molecules in 3.79 kilograms of the fictional compound Cs7(Cr5O3)4. Include the units, but do not write t
Karo-lina-s [1.5K]

Answer:

1.0555 * 10^24 molecules

Explanation:

Number of molecules = ?

Mass = 3.79  Kg = 3790 g

Molar mass of Cs7(Cr5O3)4 = 2162.25 g/mol

Number of moles = Mass / Molar mass

Number of moles = 3790 g / 2162.25 g/mol

Number of moles = 1.7528 mol

1 mol = 6.022 * 10^23 molecules

1.7528 mol = x

solving for x;

x = 6.022 * 10^23 *  1.7528

x = 1.0555 * 10^24 molecules

7 0
3 years ago
The smallest particle of a covalently bonded compound is a(n) ________.
vazorg [7]
The smallest particle of a covalently bonded compound is an atom.
8 0
4 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which of the following measurements is equal to 2,300 dL
kolbaska11 [484]
230,000. and that weird u
hope this helps
8 0
3 years ago
A 36-gram sample of water has an initial temperature of 22°c. After the sample absorbs 1200 joules of heat energy, the final tem
professor190 [17]

Answer:

≈29.94 [°C].

Explanation:

all the details are in the attachment, the answer is underlined with orange colour.

7 0
2 years ago
Other questions:
  • Mothballs are composed primarily of the hydrocarbon naphthalene (C10H8). When 1.025 g of naphthalene is burned in a bomb calorim
    13·1 answer
  • What is tissue onion make of?
    10·2 answers
  • What is the enthalpy for the reaction represented in the following energy diagram?
    6·1 answer
  • Which of the following best describes the result of using a catalyst in a chemical reaction?
    9·2 answers
  • In the Haber process, nitrogen gas is combined with hydrogen (from natural gas) to form ammonia. If ammonia is formed at 0.345 M
    13·1 answer
  • In some areas of Texas, rainfall quickly soaks through layers of porous rock and is stored naturally underground. The water is t
    10·1 answer
  • An electron moves from an excited state back to the ground state releasing
    14·1 answer
  • Which of the following substances contains a covalent bond?
    12·1 answer
  • If there are 12 people, and each person has 4 coins, there are ____ times as many coins as people.
    11·1 answer
  • Besides caffeine what other compound are found in tea leaves?​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!