1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
11

In each of the following cases, is the concentration of acid before and after dissociation nearly the same or very different? Ex

plain your reasoning: (b) a concentrated solution of a weak acid;
Chemistry
1 answer:
anygoal [31]2 years ago
5 0

Weak acids partially dissociate, they dissociate to a small intent. So after dissociation, the concentration will <u>not </u>have much significant difference.

<h3>What are weak acids?</h3>

A weak acid is one that partially separates into its ions in water or an aqueous solution. On the other hand, when strong acids are in water, they completely separate into their ions. The conjugate base of a weak acid is also a weak base, and vice versa holds true for the conjugate acid of a weak base.

At the same concentration, weak acids have a lower pH than strong acids. Strong acids are far less common than weak ones. Lemon juice and common vinegar (acetic acid) both include them (citric acid).

Learn more about Weak acid

brainly.com/question/24018697

#SPJ4

You might be interested in
Which types of bond is formed between the two chlorine atoms in a chlorine molecule?
madam [21]
They achieve stable structures by sharing their single, unpaired electron.
7 0
3 years ago
An apple is placed on a scale. the scale shows that the apple weighs 1/4 a pound. this demonstrates that the apple has
Murljashka [212]
D  is your answer. nearly everything has atoms so it cant be that 
3 0
3 years ago
What type of elements are most likely to form more than one type of ion
ss7ja [257]
Metals are the type of elements that are most likely to form more than one type of ion, for instance iron can form the ion of Fe^2+ or Fe^3+.
7 0
3 years ago
Read 2 more answers
Give me some names of a main sequence star other than the sun
ivolga24 [154]
Arietis, camelopardalis, lyncis, scorpii, cancri, canis minoris
7 0
3 years ago
Read 2 more answers
Does it take more, less, or the same amount of heat to melt 1.0 kg of ice at 0°C, or to bring 1.0 kg of liquid water at 0°C to t
Murljashka [212]

Answer : It takes less amount of heat to metal 1.0 Kg of ice.

Solution :

The process involved in this problem are :

(1):H_2O(s)(0^oC)\rightarrow H_2O(l)(0^oC)\\\\(2):H_2O(l)(0^oC)\rightarrow H_2O(l)(100^oC)

Now we have to calculate the amount of heat released or absorbed in both processes.

<u>For process 1 :</u>

Q_1=m\times \Delta H_{fusion}

where,

Q_1 = amount of heat absorbed = ?

m = mass of water or ice = 1.0 Kg

\Delta H_{fusion} = enthalpy change for fusion = 3.35\times 10^5J/Kg

Now put all the given values in Q_1, we get:

Q_1=1.0Kg\times 3.35\times 10^5J/Kg=3.35\times 10^5J

<u>For process 2 :</u>

Q_2=m\times c_{p,l}\times (T_{final}-T_{initial})

where,

Q_2 = amount of heat absorbed = ?

m = mass of water = 1.0 Kg

c_{p,l} = specific heat of liquid water = 4186J/Kg^oC

T_1 = initial temperature = 0^oC

T_2 = final temperature = 100^oC

Now put all the given values in Q_2, we get:

Q_2=1.0Kg\times 4186J/Kg^oC\times (100-0)^oC

Q_2=4.186\times 10^5J

From this we conclude that, Q_1 that means it takes less amount of heat to metal 1.0 Kg of ice.

Hence, the it takes less amount of heat to metal 1.0 Kg of ice.

5 0
3 years ago
Other questions:
  • What is the strongest metal in every single universe ?
    12·2 answers
  • The fatty acids in the tail of a phospholipid molecule are _____. nonpolar and hydrophobic
    12·1 answer
  • 20 pts!!! What are the missing coefficients needed to make this equation balanced from left to right?
    6·1 answer
  • Certain types of organisms such as fireflies and anglerfish can produce light
    11·2 answers
  • 1. If temperature is increased, the number of<br> collisions per second
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Concentrated hydrochloric acid is an aqueous solution that is 34.70 % HCl. The density of the solution is 1.19 g/mL. What mass o
    6·1 answer
  • 2. Using the article complete the following, be sure to write neatly and answer all questions in
    8·1 answer
  • Helppppppppppp it’s due today pls help and thanks
    15·1 answer
  • Explain what a convection current is? <br> who ever sees this I hope you have a wonderful day!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!