1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
9 months ago
9

which scenario will most likely result in a change to the nitrogen cycle that negatively affects plant growth?

Chemistry
1 answer:
Fed [463]9 months ago
4 0

Soil acidification is a circumstance which will most likely lead to a change in the nutrient cycling that will have a detrimental impact on plant growth.

<h3>What is the main use of nitrogen?</h3>

The chemical industry depends on nitrogen. It is used to create explosives, nylon, nitric acid, fertilizers, and colors. N must first be combined with hydrogen to create ammonia in order to create these products. The Haber process is used for this. Similar to chlorine gas and carbon monoxide poisoning, nitrous oxide poisoning is detrimental to all living things.

<h3>Why is nitrogen poisonous?</h3>

Effects on health. The majority of greater nitrogen oxides are irritants to the eyes, skin, and respiratory system. Except at deadly quantities, where arginine may kill more quickly, no2 is a corrosive chemical that, when in contact with water, produces nitric and nitrous acids.

To know more about Nitrogen visit:

brainly.com/question/2396742

#SPJ4

You might be interested in
If a hydrocarbon molecule contains a triple bond, its chemical name ends in
murzikaleks [220]
-yne. Hope this helps.
4 0
2 years ago
CK-12 Boyle and Charles's Laws if Mrs. Pa pe prepares 12.8 L of laughing gas at 100.0 k Pa and -108 °C and then she force s the
nirvana33 [79]

Answer:

The answer to your question is   P2 = 2676.6 kPa

Explanation:

Data

Volume 1 = V1 = 12.8 L                        Volume 2 = V2 = 855 ml

Temperature 1 = T1 = -108°C               Temperature 2 = 22°C

Pressure 1 = P1 = 100 kPa                    Pressure 2 = P2 =  ?

Process

- To solve this problem use the Combined gas law.

                     P1V1/T1 = P2V2/T2

-Solve for P2

                     P2 = P1V1T2 / T1V2

- Convert temperature to °K

T1 = -108 + 273 = 165°K

T2 = 22 + 273 = 295°K

- Convert volume 2 to liters

                       1000 ml -------------------- 1 l

                         855 ml --------------------  x

                         x = (855 x 1) / 1000

                         x = 0.855 l

-Substitution

                    P2 = (12.8 x 100 x 295) / (165 x 0.855)

-Simplification

                    P2 = 377600 / 141.075

-Result

                   P2 = 2676.6 kPa

3 0
3 years ago
Can someone please help
hram777 [196]

Answer: usuhduhduhdjhd

Explanation:

jaajaajaj

8 0
2 years ago
Which pair of elements are the most similar? A. Ca and F B. Na and Cl C. Ne and Ar D. K and Ca
Vinil7 [7]

Answer:

c

Explanation:

8 0
2 years ago
Early historical models of the solar system were geocentric. Which of these phrases describes a geocentric solar system?
likoan [24]

Answer:

A

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • How can a sea cave become a sea arch?
    12·1 answer
  • #1: Which type of substance is an electron-pair donor?
    8·1 answer
  • Your solution has a volume of 36 ml and a mass of 970 g. what is the density of your solution
    10·1 answer
  • 7. A gas has a volume of 300 mL at 300 mm Hg. What will its volume be if the pressure is changed to 500 mm Hg?​
    11·1 answer
  • Iron fillings sprinkled near a magnet arrange themselves into a pattern that illustrates the
    6·1 answer
  • What is the vapor pressure of ethanoic acid at 105°C?
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What do the digestive system and skeletal system have in common?
    6·1 answer
  • What is the meaning of downloading​
    10·1 answer
  • Write the complete chemical equations for production of pentanol from pentene​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!