The process of primary sequencing can take hundreds, if not thousands of years. On the contrary, the process of second succession could re-establish the communities of ecological peaks in as little as 50 years.
Not from google thank me later
GGCCATAGGTCCCTTTAGCG
I believe this is correct (I used the complementary base)
Answer:
0.120 m
Explanation:
What you need to know here is that frequency and wavelength have an inverse relationship as described by the equation
mark me as Brainliest
Sksksk isjsjs jsjsjs jsjsjs jsjsjs jsjsjs ksjss
Answer:10g of Fe produces 14.37g of Fe2O3
7g of O2 produce 46.84g of Fe2O3
Explanation:
