1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
7

What type of reaction occurs in the core of a nuclear reactor in a nuclear power plant?

Chemistry
2 answers:
ratelena [41]3 years ago
8 0
The type of reaction that occurs in the core of a nuclear reactor in a power plant is the fission reaction where the nucleus of an atom is split into smaller nucleus. Along with this splitting, high amounts of energy is being produced. This energy is used to supply power to people.
Gekata [30.6K]3 years ago
8 0

Short answer is B

Full question:

Upper H upper C l plus upper N a upper O upper H right arrow upper H subscript 2 upper O plus upper n a upper C l.

Superscript 235 subscript 92 upper U plus superscript 1 subscript 0 n right arrow superscript 90 subscript 38 upper S r plus superscript 143 subscript 54 upper X e plus 3 superscript 1 subscript 0 n.

Superscript 90 subscript 38 upper S r plus superscript 143 subscript 54 upper X e plus 3 superscript 1 subscript 0 n right arrow superscript 235 subscript 92 upper U plus superscript 1 subscript 0 n.

Upper C subscript 10 upper h subscript 8 plus 12 upper O subscript 2 right arrow 10 upper C upper O subscript 2 plus 4 upper H subscript 2 upper O.

Out of these options, the 2nd one (B) is the type that occurs in a nuclear reactor core.

You might be interested in
A potassium atom (atomic number 19) and a bromine atom (atomic number 35) can form a chemical bond through a transfer of one ele
liubo4ka [24]

Answer:

A potassium atom (atomic number 19) and a bromine atom (atomic number 35) can form a chemical bond through a transfer of one electron. The potassium ion that forms has 18 electrons. What best describes the bromide ion that forms? It is a negative ion that has one more valence electron than a neutral bromine atom.

Explanation:

7 0
2 years ago
Plz help i’m gonna cry i’m in class rn
iragen [17]

Answer:

if ur gonna cry then just dont cry its simple logic guyss!!!!!!!!!!!!

Explanation:

3 0
3 years ago
Examine the diagram of a cell.
Zepler [3.9K]

Answer:

chloroplast

Explanation:

i took the test

7 0
3 years ago
Read 2 more answers
Standard units of measure for density
Mrrafil [7]

Answer:

g/cm³ for solids,

g/ml for liquids

g/L for gases.

Explanation:

Though SI unit of density is kg/m³, for convenience we use g/cm³ for solids, g/ml for liquids and g/L for gases. Mathematically, density is defined as mass divided by volume:   ρ=m/V    

​

8 0
3 years ago
A. monotomic ionic
ASHA 777 [7]

Answer:

Binary compound

Explanation:

Binary compounds:

The compounds which are made up of the atoms of only two elements are called binary compounds.

For example:

The following compounds are binary:

HCl

H₂O

NH₃

HCl is binary because it is composed of only hydrogen and chlorine. Ammonia is also binary compound because it is made up of only two elements nitrogen and hydrogen.

water is also binary because it is also made up of only two elements hydrogen and oxygen.

SF₆ is binary compound because it consist of atoms of only two elements i.e, sulfur and fluorine.

7 0
3 years ago
Other questions:
  • A liquid that occupies a volume of 2.68 l has a mass of 2.40 kg what is the density of the liquid in kgl/?
    7·1 answer
  • What are the systematic names for each of the structures alkanes
    12·1 answer
  • Calcium carbonate is a type of hydrogenous sediment that can be buried and hardened into _____.
    13·2 answers
  • What happens when a penny is dropped from a height of 20 meters?
    14·1 answer
  • The atomic mass is a measure of _____.protons plus neutronsatomic energycharge
    8·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The concentration in (M) of bromide ions ina
    6·1 answer
  • for a theoretical yield of 22 g and actual yield of 13 g, calculate the percent yield for a chemical reaction
    7·1 answer
  • All materials are made of _____________.
    13·2 answers
  • Balance the following skeleton reactions and identify the oxidizing and reducing agents:(b) Fe(CN)₆³⁻(aq) + Re(s) →\mathrm{Fe}(\
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!