1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
2 years ago
12

Which of the following is an organic compound

Chemistry
1 answer:
nikitadnepr [17]2 years ago
4 0
Hydrogen, Oxygen and Nitrogen
You might be interested in
Most protein enzymes catalyze only one specific chemical reaction effectively. What feature of protein structure is most directl
babunello [35]

Answer;

d. the specific geometry and types of amino acids in the active site

Explanation;

-Enzymes are highly selective catalysts, meaning that each enzyme only speeds up a specific reaction. The molecules that an enzyme works with are called substrates. The substrates bind to a region on the enzyme called the active site.

-For a substrate to bind to the active site of an enzyme it must fit in the active site and be chemically attracted to it. The shape of an enzyme determines how it works. Enzymes have active sites that substrate molecules (the substances involved in the chemical reaction) fit into when a reaction happens.

8 0
3 years ago
Write the isotope notation for an element with 42 protons and 96 neutrons.
tankabanditka [31]

Answer:138

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement is correct?
sergiy2304 [10]

Answer:

a) is correct.......,.....

5 0
2 years ago
The center portion of the atom that contains the protons and neutrons is called the _____? nucleus
Virty [35]
It's called the atomic mass
3 0
2 years ago
Which element is oxidized in the reaction below? fe(co)5 (l) + 2hi (g) fe(co)4i2 (s) + co (g) + h2 (g)?
DanielleElmas [232]
Oxidation state of I is (-1) and for CO it is zero. Let's assume that the oxidation state of Fe in Fe(CO)₄I₂<span> (s) is x. For whole compound, the charge is zero.

Sum of oxidation numbers in all elements = Charge of the compound.

Here we have 1Fe , 4CO and 2I
hence we can find the oxidation state as;
 x + 4*0 + 2*(-1) = 0
 x + 0 - 2            = 0
                   x     = +2
Hence the oxidation state of Fe in product </span>Fe(CO)₄I₂ (s) is +2.

Same as we can find the oxidation state (y) of Fe in Fe(CO)₅(s).
y + 5*0 = 0
   y        = 0

Since oxidation state of Fe increased from 0 to +2, the oxidized element is Fe in the given reaction.
5 0
2 years ago
Other questions:
  • An aqueous potassium iodate (KIO3) solution is made by dissolving 553 grams of KIO3 in sufficient water so that the final volume
    8·2 answers
  • What kind of electrons are involved in chemical bonding?
    8·1 answer
  • W myFLVS
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Chemistry intro please help
    5·1 answer
  • In the explosion of a hydrogen-filled balloon, 0.40 g of hydrogen reacted with 3.2 g of oxygen. How many grams of water vapor ar
    15·1 answer
  • The fossil record is the record of life on earth preserved in rock as fossils. The fossil record provides evidence of what types
    15·2 answers
  • The molarity of a solution is 2.1m. How many mole of solute is in a 7.4 liter solution
    10·1 answer
  • Grams would be best to use to measure the mass of which of the following
    11·1 answer
  • Help me Pleaseeeeeeeee
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!