Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
A. How religion and philosophy different
All the other choices (b-d) can be explained by science while a can be explain by history I think
We have gravity here on earth while in space there’s none
Answer:

Explanation:
Hello there!
In this case, according to the given chemical reaction:
2 Al + 3 Cl2 --> 2 AlCl3
Whereas there is a 2:3 mole ratio of aluminum to chlorine; it will be possible for us to calculate the required grams of aluminum by using the equality 22.4 L = 1 mol, the aforementioned mole ratio and the atomic mass of aluminum (27.0 g/mol) to obtain:

Regards!
Answer: V = 33.9 L
Explanation: We will use Charles Law to solve for the new volume.
Charles Law is expressed in the following formula. Temperatures must be converted in Kelvin.
V1 / T1 = V2 / T2 then derive for V2
V2 = V1 T2 / T1
= 35 L ( 308 K ) / 318 K
= 33.9 L