1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
3 years ago
15

How does radiocarbon (or uranium) dating help us better understand the world

Chemistry
1 answer:
navik [9.2K]3 years ago
4 0

Here we have to discuss the understanding of world through radiocarbon or uranium.

The radiocarbon or uranium helps us to determine the age of the world.

All uranium or radiocarbon elements after ejecting the radioactive rays convert to non-radioactive element lead (²⁰⁸Pb). If we assume that during the generation of world there were not any amount of lead was present i.e. only uranium or radiocarbon was present. Then by analysis of any uranium or radiocarbon at the present date one can determine the age of the world as follows:

In present moment we know that the ratio of uranium (U) and lead (Pb) in any uranium ore is 10:3 (gram atom ratio)

So, \frac{the amount of uranium at the generation of world}{The remaining amount of uranium on present day} = \frac{10+3}{10}

Therefore, from the equation: ln\frac{N_{0} }{N} = λt (where λ = rate of dissociation of uranium, t = time); we can write:

t = λ⁻¹ ln\frac{N_{0} }{N} =  λ⁻¹ln\frac{13}{10}.

On plugging the dissociation rate of uranium we can obtain the age of the world, which is nearly 1.5×10⁹ years.

Thus the use of radioactive element to understand the world is explained.

You might be interested in
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Which of the following questions is outside the scope of science?
Airida [17]
A. How religion and philosophy different
All the other choices (b-d) can be explained by science while a can be explain by history I think
4 0
3 years ago
Why do astronauts on the moon seem like they're "Walking on springs" while on earth we are firmly attached to the ground
Sergio [31]
We have gravity here on earth while in space there’s none
8 0
2 years ago
Read 2 more answers
Under the right conditions aluminum will react with chlorine to produce aluminum chloride.
salantis [7]

Answer:

m_{Al}=9.42gAl

Explanation:

Hello there!

In this case, according to the given chemical reaction:

2 Al + 3 Cl2 --> 2 AlCl3

Whereas there is a 2:3 mole ratio of aluminum to chlorine; it will be possible for us to calculate the required grams of aluminum by using the equality 22.4 L = 1 mol, the aforementioned mole ratio and the atomic mass of aluminum (27.0 g/mol) to obtain:

m_{Al}=11.727LCl_2*\frac{1molCl_2}{22.4LCl_2}*\frac{2molAl}{3molCl_2}  *\frac{27.0gAl}{1molAl} \\\\m_{Al}=9.42gAl

Regards!

8 0
3 years ago
A balloon is filled with 35.0 L of helium in the morning when the temperature is 35.00 oC.
nexus9112 [7]

Answer: V = 33.9 L

Explanation: We will use Charles Law to solve for the new volume.

Charles Law is expressed in the following formula. Temperatures must be converted in Kelvin.

V1 / T1 = V2 / T2 then derive for V2

V2 = V1 T2 / T1

= 35 L ( 308 K ) / 318 K

= 33.9 L

5 0
3 years ago
Other questions:
  • In the reaction HCl + NaOH → NaCl (aq) + H2O , if 45.0 milliliters of a 2.0 M HCl react in an excess of NaOH, how many grams of
    7·1 answer
  • If a 0.2g of oil consumed 1ml of sodium thiosulphate, calculate its iodine value and classify the oil?
    14·1 answer
  • Drag the description to the category
    11·1 answer
  • How many hydrogen atoms are in 5 molecules of isopropyl alcohol, cmc010-1.jpghmc010-2.jpgo?
    6·1 answer
  • Does anyone know this one???
    6·1 answer
  • Now they feel it is best to have you identify an unknown gas based on its properties. Suppose 0.508 g of a gas occupies a volume
    5·1 answer
  • Gallium has two naturally occurring isotopes. 69Ga (68.9257 amu) is the more abundant isotope, at 60.400%. If the atomic mass of
    10·1 answer
  • Find the mass ratios and atomic ratios of the following compounds.
    15·1 answer
  • (image attached) AP CHEM ACID BASE Is my answer correct? I will mark as brainliest if you answer me. I don't need an explanation
    5·1 answer
  • If 3.66•10^23 molecules of a substance have a mass of 24.31g, what is the molar mass of the substance?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!