1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
15

A solution of ph 5 has _____ times more hydrogen ions than that of pure water.

Chemistry
1 answer:
Alik [6]3 years ago
3 0
PH measures the concentration of hydrogen ions on the log 10 scale. Thus, a pH 5 solution has 2 order of magnitude difference from that of pure water, which has a pH of 7.

Therefore, 10^{2} = 100. A solution of pH 5 has 100 times more hydrogen ions that that of pure water.
You might be interested in
A 1.42-g sample of a pure compound with formula m2so4 was dissolved in water and treated with an ex- cess of aqueous calcium chl
solong [7]

The reaction between m_{2}SO_{4} with calcium chloride can be shown as-m_{2}SO_{4}+CaCl_{2}→CaSO_{4}↓+2mCl. The molecular weight of CaSO_{4} is 136.14g. The weight of sulfate ion is 96.06g. The molecular weight of m_{2}SO_{4} = (2×m + 96.06). From the reaction we can see that 1 mole of calcium chloride reacts with 1 molesm_{2}SO_{4} to produce 1 mole of calcium sulfate. Now 1.36g of calcium sulfate is equivalent to 1.36/136.14=9.989×10^{-3} moles of calcium sulfate.

Thus, 9.989×10^{-3} moles of m_{2}SO_{4} reacts in this reaction.

Let assume the atomic mass of m is x thus the molecular weight of m_{2}SO_{4} is 2x+96.

So we may write 9.989×10^{-3}× (2x+96) =1.42

Or, 2x + 96 = 142.146

Or, 2x = 46.146

Or, x = 23.073

Thus the atomic mass of m is 23.073. The atom (m) is sodium (Na).  

8 0
3 years ago
Which aqueous solution has the highest boiling point?a. 0.20 M NaClb. 0.10 M CaCl2c. 0.1 M Ga2(SO4)3d. 0.2 M C6H12O6
abruzzese [7]

Answer:

c. 0.1 M Ga₂(SO₄)₃

Explanation:

The boiling point increasing of a solvent due the addition of a solute follows the formula:

ΔT = K*m*i

<em>Where K is boiling point increasing constant (Depends of the solute), m is molality = molarity when solvent is water, and i is Van't Hoff factor.</em>

<em />

That means the option with the higher m*i will be the solution with the highest boiling point:

a. NaCl has i = 2 (NaCl dissociates in Na⁺ and Cl⁻ ions).

m* i = 0.20*2 = 0.4

b. CaCl₂; i = 3. 3 ions.

m*i= 0.10M * 3 = 0.3

c. Ga₂(SO₄)₃ dissolves in 5 ions. i = 5

m*i = 0.10M*55 = 0.5

d. C₆H₁₂O₆ has i = 1:

m*i = 0.2M*1 = 0.2

The solution with highest boiling point is:

<h3>c. 0.1 M Ga₂(SO₄)₃</h3>
3 0
2 years ago
if a leaf falls from a tree we assume that it is in free fall and not affected by air resistance, how many force vectors does th
lakkis [162]
Just the force of gravity down. 
7 0
3 years ago
Is granite rock a compound, element, mixture? Explain
Ghella [55]
It is a <u>mixture</u> of minerals mainly of corps that crystalizes of magma below earths surface.
7 0
3 years ago
EASY QUICK CHEM QUESTION!! Which line indicates a higher reaction rate?
ad-work [718]
2. B because it has a lower activation energy.

idk because you have no picture with the lines on it

3 0
3 years ago
Read 2 more answers
Other questions:
  • Two atoms bonded together will remain some distance apart, minimizing the Question 1 options: A) potential energy of the bond. B
    10·1 answer
  • Electrical charge may be rapidly moved from one body to another by means of a(n)
    8·2 answers
  • Describe how to find calorie content in food
    14·1 answer
  • What is the difference between an onion cell and the cheek cell
    11·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 10.How do you make sure there is no cross contamination of your samples of<br> substances?
    15·1 answer
  • Which of the following parts of a forest ecosystem could not become a fossil?
    13·2 answers
  • HELP PLEASE I WILL GIVE YOU BRAINLIEST
    9·1 answer
  • Whats the molar volume (of a solution)?
    15·1 answer
  • What factor would speed up a chemical reaction
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!