1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
12

Which statement is correct about this food? It contains disaccharides

Biology
1 answer:
Eduardwww [97]3 years ago
6 0

I'm sorry but there is no any statement and which food you are talking about?

You might be interested in
Which of these accurately describes Newton’s third law?
taurus [48]

The answer is d I hope this helps

3 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
Why might a urine sample taken early in the morning differ from a sample taken soon after dinner?
Lostsunrise [7]
Because the urine in the morning will be less contaminated than the urine after dinner 
6 0
4 years ago
Which are two characteristics of leisure​ travelers?
Marizza181 [45]
<span>Two characteristics of leisure travelers is that they often will travel by car, and generally they take shorter trips. The whole idea of leisure travel is to take a little vacation from the chores of everyday life. It is generally characterized as people staying in nice hotels, relaxing, touring, and experiencing something new, fun and exciting.</span>
8 0
3 years ago
Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the collateral ganglia. a
alex41 [277]

Specialized ganglionic sympathetic neurons that release hormones into the bloodstream are found within the adrenal glands.

<h3>What is adrenal gland?</h3>
  • A little gland that produces noradrenaline, adrenaline, and steroid hormones.
  • These hormones assist in maintaining healthy blood pressure, heart rate, and other vital bodily functions.
  • Immune system, blood pressure, stress response, metabolism, and other critical processes are all controlled by hormones that are produced by adrenal glands.
  • The cortex and the medulla, the two components that make up an adrenal gland, are each in charge of manufacturing a separate hormone.
  • Problems with one, both, or other glands, such as the pituitary gland, can result in diseases of the adrenal glands.
  • When the adrenal glands create either an excessive amount of hormones or an excessive amount of hormones from external sources, several diseases may arise.
  • Since the adrenal glands are essential for human survival, if both are destroyed, the patient will need to take drugs and hormone supplements.

Learn more about adrenal gland here:

brainly.com/question/1406904

#SPJ4

8 0
2 years ago
Other questions:
  • Which foods should the nurse encourage the mother to offer to her child with iron-deficiency anemia?
    5·1 answer
  • What is the state vs. nonstate debate in hypnosis? Discuss any one state theory and nonstate theory
    6·2 answers
  • Which organ will first receive sugars after they are absorbed into the blood?
    8·1 answer
  • What does figure 13-2 show?
    10·1 answer
  • Gene flow is partially responsible for<br> - genetic sameness.<br> -genetic variation.
    8·1 answer
  • Which of the following statements about government sanctioned activities to restore ecosystems is true? a. Government sanctioned
    7·1 answer
  • Stored energy or energy of position is known as<br> Energy *<br> 1.)Potential<br> 2.)Kinetic
    9·2 answers
  • increasing intracellular cAMP leads to smooth muscle relaxation by: Group of answer choices inhibiting IP3 channels, leading to
    8·1 answer
  • General characteristics of tissue​
    15·2 answers
  • Data collected from part of a population is a _______.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!