1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
8

According to reference table adv-10, which reaction will take place spontaneously?

Chemistry
1 answer:
olga_2 [115]3 years ago
5 0
Missing table!! write the elements with the first letter of the symbol with Upper Caps letters!!!

http://www.chemeddl.org/services/moodle/media/QBank/GenChem/Tables/EStandardTable.htm

<span>Ni2+ +Pb(s) → Ni(s) + Pb2+
</span>The potential of the oxidation of Pb(s) --> Pb2+(aq) is 0.126 V 
The potential of the reduction go Ni2+(aq) --> Ni(s) is -0.25 V 

<span>Add the two together and the potential for the reaction is -0.124 V (NO SPONTANEOUS THE SIGN IS NEGATIVE)

</span><span>au3+ + al(s) → au(s) + al3+Au3+(aq) ->   Au(s)  +1.5 VAl -> Al3+  +1.66VV= 3.16 (SPONTANEOUS THE SIGN OF THE PONTENTIAL IS POSITIVE)</span><span>Sr2+ + Sn(s) → Sr(s) + Sn2+
</span>
Sr2+(aq) + 2 e–  <span>  Sr(s)  V= -2.89V
</span>Sn -> Sn2+ V= 0.14 V
V= -2.75 V (no spontaneous)

<span>Fe2+ + Cu(s) → Fe(s) + Cu2+
</span>Fe2+(aq) + 2 e–<span>  </span><span>  Fe(s)  V= -0.44 V
</span>Cu -> C2+  V = - 0.337V

V= - 0.777V (no spontaneous)
You might be interested in
Which image is cohesion stronger than adhesion and which image is adhesion stronger than cohesion
matrenka [14]
Image C is adhesion stronger and Image D is cohesion stronger
5 0
3 years ago
Which separation techniques will you apply for the separation of the following? a) oil from water b) kerosene and petrol c) salt
REY [17]

Answer:

A) Separating funnel method

B) Simple Distillation

C) Evaporation

D) Sublimation

E) It is based on the principle of separation whereby even though two substances are dissolved in the same solvent, their respective solubilities could be different. Thus, the component that has more solubility will rise fastest and will therefore get separated from the mixture.

Explanation:

A)

B) Kerosene and petrol are both miscible liquids and the difference in their boiling point temperature is not more than 25°C. Thus, we make use of Simple distillation.

C) Can be separated by evaporation where the water is boiled and it evaporates and leaves the salt behind

D) To separate camphor from salt, we use sublimation so the camphor can change directly from solid to the gas state without passing through the liquid state.

E) Chromatography is used to separate components of a mixture.

It is based on the principle of separation whereby even though two substances are dissolved in the same solvent, their respective solubilities could be different. Thus, the component that has more solubility will rise fastest and will therefore get separated from the mixture.

7 0
3 years ago
Plsss help <br> will mark BRAINLIEST
satela [25.4K]

Answer:

c

Explanation: just a chemachal

5 0
3 years ago
What is a key difference between an electrolytic cell and a voltaic cell? The anode is where the oxidation takes place. The cath
Volgvan
the answer is "There is an outside energy source." in voltaic cells, there is not need of an external source of energy because they involve spontaneous reactions. 

in both types of cells, the electrons move from anode to cathode, the anode is where oxidation takes place and cathode for reduction (an ox, red cat). also both have two half reactions.
6 0
3 years ago
Molten zinc chloride can be electrolysed.
Crank

Answer: The products of electrolysis are Zn(l) and Cl_2 gas

Explanation:

Electrolysis of a subastance is breaking it into its constituents by the action of electrical current.  

In the electrolysis of molten zinc chloride, zinc metal is produced at the cathode which is a negative electrode and chlorine gas produces as the anode which is a positive electrode.

ZnCl_2(l)\rightarrow Zn^{2+}+2Cl^-

At anode : 2Cl^-(l)\rightarrow 2e^-+Cl_2(g)

At cathode : Zn^{2+}(l)+2e^-\rightarrow Zn(l)

5 0
3 years ago
Other questions:
  • Which of the following is a function of the geosphere
    5·1 answer
  • PLZZ HELP ME ASAP
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Layer of Earth made up of the crust and upper mantle
    15·1 answer
  • You can purchase hydrochloric acid in a concentrated form that is 37.0% HCl by mass and that has a density of 1.20 g/mL. Describ
    11·1 answer
  • What is the change in internal energy (ΔΕ) of a system when 5 kJ of work is done on the system while it releases 13 kJ of energy
    7·1 answer
  • What does inductive effect mean?​
    13·1 answer
  • How many molecules are contained in 5.7 gms of CaCO3​
    9·1 answer
  • How long does it take light to travel from the Earth to the Sun? The speed of light is 2.998×10^5 km/s and the Sun is 1.496×10^8
    6·1 answer
  • What can physical properties not separate?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!