There’s going to be 8 neutrons presented
Answer: (C) Vaporizing
Explanation:
Vaporization is the process in which the substance change the state of of liquid into the gas state.
The vaporization process require the largest input of the energy as when the state is in the solid state then, the solid substances contain the strong forces of the attraction and they require high energy to break these strong bonds.
For changing the liquid state into the gases state we require to overcome the surface tension and require enough energy for acquiring the vaporization state.
Therefore, option (C) is correct.
Reaction equation:
Al(OH)₃ + 3HCl → AlCl₃ + 3H₂O
Moles of Al(OH)₃:
moles = mass/Mr
= 1.51 / (27 + 17 x 3)
= 0.019
Molar ratio Al(OH)₃ : HCl = 1 : 3
Moles of HCl required = 0.019 x 3
=0.057
concentration = moles/volume
volume = 0.057 / 0.1
= 0.57 dm³
= 570 ml
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:H2=11.4g
CH4=28.6g
Explanation:The complete combustion of the two gases can be represented by a balanced reaction below
1. CH4 +2O2___CO2+2H2O
2.2H2+O2___2H2O
Combining the two we have CH4 +2H2+3O2___
CO2+4H2O
Since the mixture contains 40gof CH4 and 2, therefore 20g of CH4 and 8g of H2 combines.
Calculated from their molecular Mass i.e CH4 12+4×2)=20 and 2H2= 2×2×2=8g
Mass of CH4=20/28×40=28.6g
2H2=8/28×40=11.4g
