1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
3 years ago
11

Cells use vesicles to transport substances with?

Biology
1 answer:
Nuetrik [128]3 years ago
8 0
<span>Vesicles are used to transport items in many different circumstances, so I'm not quite sure how to answer your question. Vesicles are used when transporting to and from the golgi apparatus, also when transporting molecules to lysosomes. They are even used when undergoing exocytosis. Basically, they are used to carry items/molecules/wastes around within cells

</span>
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which scenario describes a way that an abiotic factor can impact a marine system? Liquid water turning into solid ice encourages
Sloan [31]

Answer:

Rapid increases in water temperature cause extensive fish kills

Explanation:

Biotic factors are all living organisms that contribute to an ecosystem. On the other hand, abiotic factors are non-living factors, such as climatic factors (temperature, rainfall, wind), edaphic factors (soil type, soil texture, soil aeration etc). Changes of abiotic factors can have a huge influence on living organisms of ecosystem. The effects might be benefical or harmful.

Some of the most common abiotic factors that can impact a marine ecosystem are water temperature, currents, light, alkalinity, oxygent concentration etc.

4 0
2 years ago
Describe the major fields of study that contribute to environmental science
IRISSAK [1]

Answer:

Environmental Sciences is a multidisciplinary academic field that integrates biological, physical and information sciences for the study of the environment and solutions to environmental problems. These sciences include physics, ecology, zoology, biology, chemistry, mineralogy, oceanography, geology, soil sciences, atmosphere sciences and geography. The environmental sciences emerged from the fields of natural history and medicine. Today, they allow an integrated, quantitative and interdisciplinary approach to the study of environmental systems.

Related areas of study include environmental studies and environmental engineering. Environmental studies integrate social sciences to understand human relations, perceptions and policies regarding the environment. Environmental engineering focuses on design and technology designed to improve the quality of the environment. Environmental problems almost always include the interaction of physical, chemical and biological processes. Environmental scientists work on topics such as understanding ground processes, assessing alternative energy systems, controlling and mitigating pollution, managing natural resources and the effects of global warming, applying systemic analyzes to environmental problems.

Environmental sciences became an active field of scientific research in the 1960s and 1970s, due to the need for a multidisciplinary approach to analyzing complex environmental problems, the emergence of various environmental laws requiring specific research protocols, and increasing public awareness. the need for action to solve environmental problems.

3 0
3 years ago
What is the temperature, in degrees Celsius, of a substance with a temperature of 49K?
Leviafan [203]
49 Kelvin = -224.15 Celsius

I believe this is the answer.
6 0
3 years ago
Read 2 more answers
Jacob and Monod were intellectually primed to draw the conclusions they did concerning regulation of the lac operon. In part, th
Alika [10]

Answer:

Jacob and Monod were intellectually primed to draw the conclusions they did concerning regulation of the lac operon. In part, this was due to their fascination with mechanisms of enzyme regulation. They knew that the activity of some enzymes is regulated when their reaction product binds to the enzyme, changing its shape and therefore its activity. This knowledge allowed them to easily make the intellectual leap to propose B) allosteric regulation of the repressor

Explanation:

When we talk about the mechanisms of enzyme regulation, we refer to allosteric regulation of the repressor. The Allosteric control of transcriptional regulatory proteins allows organisms to react to changes in environmental and metabolic conditions. Also, it is s a thermodynamic phenomenon. When it binds one molecule, the affinity with which a protein binds to a second molecule is altered.

7 0
3 years ago
Other questions:
  • A microscopist is viewing a very small organelle, the ribosome, which measures about 20 nanometers across. What microscopic inst
    14·1 answer
  • The great hornbill and the toucan both eat the same fruit, insects, and nuts. They both live in the rainforest. Their large bill
    15·2 answers
  • The process by which the particles of a gas randomly pass through a tiny opening is called
    15·1 answer
  • Which of the following is not a reason the nitrogen cycle is important to life on Earth?
    14·1 answer
  • The arm *blank* flexes the arms at the elbows
    15·1 answer
  • Kathy downloaded a few photos of local organic farms from Flickr's Creative Commons (CC) pool. She follows the rules of the phot
    8·1 answer
  • For which reasons would a male peacock spread his tail feathers?
    11·1 answer
  • 7(c)(i). The diagram 7.2 shows the materials used by Claudia for preparing
    5·1 answer
  • Placer mining involves _______ to extract minerals.
    11·2 answers
  • What extended schleiden's hypothesis by suggesting that animal tissue was made up of cells?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!