1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
3 years ago
5

Plz Help! Instructions are below↓

Biology
1 answer:
erastova [34]3 years ago
3 0

Answer:

Do u have Socratic u can take a picture of any assignment and they will help u out with it and give answers

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which year had the least precipitation?
oksano4ka [1.4K]

Answer:

2000

Explanation:

It is very close between 1990 and 2000, but from what I can see, 2000 had the least precipitation.

8 0
3 years ago
How does a hydrometer work?
bija089 [108]
A hydrometer is an instrument that measures the specific gravity (relative density) of liquids. The ratio of the density of the liquid to the density of water. A hydrometer is usually made of glass, and consists of a cylindrical stem and a bulb weighted with mercury or lead shot to make it float
5 0
4 years ago
1. What is a green space?
Tju [1.3M]

Answer:area of grass and trees and other vegetation

Explanation:set apart for recreational use or aesthetic purposes in urban environments

7 0
3 years ago
Which type of organism evolved later than the others?
Arlecino [84]
Mammals evolved later
4 0
3 years ago
Other questions:
  • Describe how the two nucleotide chains in DNA are bonded together.
    15·1 answer
  • Often when a family member is dying, the client and the family are at different stages of grieving. during which stage of a clie
    6·1 answer
  • Where are the enzymes for digestion of disaccharides and small polypeptides located?
    5·1 answer
  • 6. The breaking down and changing of rocks at or near Earth's surface is called
    13·2 answers
  • What causes an increase in the number and intensity of small earthquakes before an eruption?
    9·1 answer
  • The...........is a structure that supplies oxygen and nutrients to the fetus .
    6·1 answer
  • ¿A qué organismos pueden causar enfermedades los hongos?
    7·1 answer
  • What would happen to the rate of respiration if we put the yeast into boiling water to make the yeast suspension
    13·1 answer
  • The thin skin that appears to form on water’s surface occurs because of
    11·1 answer
  • Single cell transcriptomics provides insights into hypertrophic cardiomyopathy Wehrens et al. (Eva Van Rooij), 2022, Cell Report
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!