1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

What is the volume of 5.00 mole of an unknown gas at STP

Chemistry
1 answer:
ivann1987 [24]3 years ago
5 0

Answer:

What is the volume of gas at 2.00 atm and 200.0 K if its original volume was. 200.0 L at STP  How many moles of nitrogen gas will occupy a volume of 150 L at STP? n=pr 11.00atm) What is the mass of 5.00 L of NO2 gas at STP? PV = nRT.

Explanation:

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Describe the difference between Al3+<br> and N3-
wariber [46]
Al3+ is cation due to its positve charge
N3- is an anion due to its negative charge
4 0
3 years ago
T or F: The mass of an answer is so small it is rounded to 0 amu
Nutka1998 [239]
True because it doesn’t count as a full number
6 0
3 years ago
How many molecules are contained in 0.800 mol o2?
Ksenya-84 [330]
Multiply .800 moles of O2 by Avagadro's number divided by 1 mole. This will get rid of the moles on the bottom and leave you with molecules. So technically .800 times 6.02x10^23.
6 0
3 years ago
What temperature is absolute zero?<br> A. OK<br> B. 0°F<br> O C. O molecules<br> D. 0°C
KiRa [710]

Answer:

o k

Explanation:

ok ok .......o k....ok aaaaaaa

6 0
3 years ago
Read 2 more answers
Other questions:
  • Question 22 A mixture of krypton and argon gas is expanded from a volume of 33.0L to a volume of 61.0L , while the pressure is h
    14·1 answer
  • What is the final concentration if 75.0 ml of a 3.50 m glucose solution is diluted to a volume of 400.0 ml?
    12·1 answer
  • Which element has the same number of energy levels as aluminum (Al) and the same number of valence electrons as calcium (Ca)?
    11·2 answers
  • The continents of Africa and South America used to "fit together" like puzzle pieces. About how far back in time would you have
    7·1 answer
  • Why must chemical equations be balanced?
    6·1 answer
  • The______of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.Th
    7·2 answers
  • Which of the following is an example of sound waves being reflected?
    15·1 answer
  • Does any one here have morsin solutions?
    6·1 answer
  • A Compound Contains Two or more _______. 
    11·2 answers
  • A gas initially has a volume of 300. mL at a pressure of 1.0 atm, what will the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!