1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
3 years ago
9

With statement best explains why compounds have different properties then the elements that form them

Biology
1 answer:
Lina20 [59]3 years ago
4 0
I'm pretty sure the answer is A.
You might be interested in
Why are carbon dioxide concentrations expected to increase?
SVETLANKA909090 [29]
Carbon dioxide concentrations are expected to increase, because fossil fuel burning is expected to increase, because of an increase in agriculture and because more land will have to be cleared for increasing populations and agricultural use.
5 0
3 years ago
Read 2 more answers
Cystic fibrosis is a genetic disease in humans in which the CFTR protein, which functions as a chloride ion channel, is missing
KiRa [710]

Answer:

ABC transporter protein

Explanation:

ABC transporter protein refers to the ATP binding cassette protein which utilizes the AT energy to transport the substrates from one side to another side. The ABC proteins are one of the oldest proteins known in the organisms.

The CFTR protein which acts as a chloride channel in the membrane which transports the chloride ions across the membrane utilizes the ATP energy in the transport.

Thus, ABC transporter protein is correct

4 0
3 years ago
Describe ways in which a healthy artery differs from an artery affected by coronary heart disease
JulsSmile [24]

Answer:

A healthy artery is wider and has no blockages. The lumen (which is the hole in the centre of the artery), is open and clear. This means there is more blood flow. An artery of a person suffering from coronary heart disease is often blocked, usually by a fatty deposit. This means the blood does not flow as well. (See diagram, in which I would draw two arteries, one with a blockage of fatty deposit, one clear and healthy).

hope this helped you

please mark as the brainliest (ㆁωㆁ)

3 0
3 years ago
BRAINLIEST Which of the following adaptations will help a plant survive in a desert? A. Stem that stores water B. Shallow root s
sergij07 [2.7K]
Hello,

Here is your answer:

The proper answer to this question is option A "<span>Stem that stores water".

For example: A Cactus stores water in its steam in order to survive in the desert.

Your answer is A.

If you need anymore help feel free to ask me!

Hope this helps!</span>
7 0
3 years ago
Read 2 more answers
_____ cannot be grown in a lab culture unless living cells are present.
adelina 88 [10]

Answer:

B. Viruses

Explanation:

Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy. Even though they definitely replicate and adapt to their environment, viruses are more like androids than real living organisms.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What type of molecule encodes genetic information in streptococcus pneumoniae?
    12·1 answer
  • Running is an activity that causes the cells in the muscular system to use oxygen at a faster rate. which system responds by del
    9·1 answer
  • True or false? When heat is absorbed by an object the speed of the particles in the object is unchanged. If it is false what wor
    10·1 answer
  • What is used to power ships and machinery
    14·1 answer
  • How many significant figures should the products 62.25 37.4 have
    10·2 answers
  • Compare and contrast a cell<br> membrane and cell wall?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • PARTA
    6·2 answers
  • Lead is melted and is poured into a mold to make fishing weights. This is an example of a________change.
    10·1 answer
  • NEED ANSWERS ASAP!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!