1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
4 years ago
12

Which of these is the best example of Newton's third law?

Chemistry
1 answer:
Stella [2.4K]4 years ago
4 0

Answer: the second option is the best option

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Why do people poop it is for my chemistry class
algol13
The digestive system takes the nutrients from the food you eat as well as the water. The leftover matter is excreted through the body as feces, or poop. Hope I helped :)
3 0
4 years ago
Read 2 more answers
Which of the following has the most atoms per mole?
BabaBlast [244]

Answer:

e) Na₃PO₄

Explanation:

a) BaSO₄

1 mole of BaSO ₄ = 6.022×10²³ molecules

1 mole of BaSO ₄ contain 1 atom of Ba one atom of S and four atoms of O.

Total number of atoms = 6 atoms

6.022×10²³ × 6 atoms = 36.132 ×10²³ atoms

b) NaNO₂

1 mole of NaNO₂= 6.022×10²³ molecules

1 mole of NaNO₂ contain 1 atom of Na one atom of N and two atoms of O.

Total number of atoms = 4 atoms

6.022×10²³ × 4 atoms = 24.088 ×10²³ atoms

c)KMnO₄

1 mole of KMnO₄ = 6.022×10²³ molecules

1 mole of KMnO₄ contain 1 atom of K one atom of Mn and four atoms of O.

Total number of atoms = 6 atoms

6.022×10²³ × 6 atoms = 36.132 ×10²³ atoms

d) KCl

1 mole of KCl = 6.022×10²³ molecules

1 mole of KCl contain 1 atom of K one atom of Cl.

Total number of atoms = 2 atoms

6.022×10²³ × 2 atoms = 12.044 ×10²³ atoms

e) Na₃PO₄

1 mole of Na₃PO₄ = 6.022×10²³ molecules

1 mole of Na₃PO₄ contain 3 atom of Na one atom of P and four atoms of O.

Total number of atoms = 8 atoms

6.022×10²³ × 8 atoms = 48.176×10²³ atoms

3 0
3 years ago
Which of the following reactions involves a single compound producing two or more simpler substances?
castortr0y [4]

Answer:

Decomposition or cracking

Explanation:

In a decomposition or cracking reaction, a single compound produces two or more simpler substances.

It involves the formation of two or more products from a single reactant.

  A →  B + C

A is the single reactant

B and C are the products

The driving force for such a reaction is the is high positive heat of formation of the compound that is, extreme instability of the compound.

6 0
3 years ago
What happens when iron is placed in a solution containing copper ions?
alexgriva [62]

When an iron is dipped in Copper Sulphate

Solution this reaction between them and

copper sulphate change into blue color to light

green color. This show that iron is more

reactive then copper, it can to replace copper

from CuSO4 , CuSO4 is of blue color and

FeSO4 is light green color.

Hope it helps

8 0
4 years ago
Other questions:
  • The world's population:
    10·2 answers
  • Create the bonds between these elements<br> a) K and P<br> b) N and Ca<br> c) C and H
    10·1 answer
  • The percentage yield for the reaction
    15·1 answer
  • Which element has the same number of energy levels as aluminum (Al) and the same number of valence electrons as calcium (Ca)?
    11·2 answers
  • The boiling of water results in a physical change in matter form
    15·2 answers
  • An ideal gas cannot exist outside of ideal gas conditions<br><br> true or false ?
    7·1 answer
  • An increase in which of the following does not increase the rate of a chemical reaction?
    15·1 answer
  • What would be the anode<br> a magnesium and zinc galvanic cell?
    9·2 answers
  • For a covalent bond to be polar, the two atoms that form the bond must have:.
    10·1 answer
  • Why is furan an aromatic compound?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!