1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11111nata11111 [884]
3 years ago
7

Which two characteristics do all flowering plants have in common?

Chemistry
1 answer:
Mamont248 [21]3 years ago
4 0

Answer: They have vessels, and produce seeds.

Explanation: Flowering plants have vascular tissue and use seeds to reproduce.

You might be interested in
How many moles of dinitrogen monoxide are present in 9.3 x 10^22 molecules of this compound?
Step2247 [10]

Answer:

<h2>0.15 moles</h2>

Explanation:

To find the number of moles in a substance given it's number of entities we use the formula

n =  \frac{N}{L} \\

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities.

From the question we have

n =  \frac{9.3 \times  {10}^{22} }{6.02 \times  {10}^{23} }  \\  = 0.154485...

We have the final answer as

<h3>0.15 moles</h3>

Hope this helps you

8 0
3 years ago
It _______ moving right now.
Arte-miy333 [17]

Answer:

Umm what do i do to help you??

7 0
2 years ago
Read 2 more answers
Which is the correct order of planet, galaxy, solar system, universe? From smallest to largest?
Nana76 [90]
Planet, solar system, galaxy, universe
5 0
3 years ago
Read 2 more answers
What type of energy is represented by a battery
rewona [7]

Answer:

Electrical Energy

Explanation:

Batteries store chemical energy and change it to electrical energy.

8 0
3 years ago
Read 2 more answers
A few pieces of dry ice, CO2(s), at -78°C are placed in a flask that contains air at 21°C. The flask is sealed by placing an uni
astra-53 [7]
The dry ice absorbs heat from the air in the flask and become CO2 gas directly. So the heat flow from air to dry ice. And the CO2 gas increase the amount of the air. Though the temperature decreases, the balloon still inflates.
8 0
3 years ago
Other questions:
  • What is the symbol for the element whose atoms have 40 electrons each?
    13·1 answer
  • Be sure to answer all parts.Classify each nitrogen-containing functional group in the anesthetic lidocaine according to whether
    10·1 answer
  • When 0.200 grams of Al reacts with 15.00 mL of a 0.500 M copper(II) chloride solution, how many moles of solid Cu would be produ
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How would a disease that damages the nucleus most directly affect the functioning of cells?
    15·1 answer
  • The pK1, pK2, and pKR of the amino acid lysine are 2.2, 9.1, and 10.5, respectively. The pK1, pK2, and pKR of the amino acid arg
    12·1 answer
  • What is the average kinetic energy of 1 mole of a gas that is at 100 degrees Celsius?
    6·1 answer
  • Explain the following observation. Treatment of alkyl chloride A with NaOCH2CH3 yields only one product B, whereas treatment of
    6·1 answer
  • This question is about iron three of the raw material added to a blast furnace used to extract iron from henatite are coke hemat
    12·1 answer
  • What is true at the equivalence point of a
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!