1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
3 years ago
13

What is the mass of 4.32 mol GaI3? A. 455 g B. 1,230 g C. 1,720 g D. 1,950 g

Chemistry
2 answers:
daser333 [38]3 years ago
7 0

Answer:

D) 1950 g

Explanation:

<u>Given:</u>

Moles of GaI3 = 4.32

<u>To determine:</u>

Mass of 4.32 moles of GaI3

<u>Explanation:</u>

Mass of 1 mole of GaI3 = atomic mass Ga + 3(atomic mass I)

= 69.723  + 3(126.904) =450.435 g

since:

mass of 1 mole of GaI3 is 450.435 g

Therefore, the corresponding mass of 4.32 moles of GaI3 would be:

=\frac{4.32\ moles\ GaI3 * 450.435 g\ GaI3}{1\ mole\ GaI3} =1946 \ g

Sliva [168]3 years ago
5 0
The answer is D.1.950 g

The sponsoring editor for this book was Kenneth P. McCombs and the production supervisor was Sherri Souffrance. It was set in Times Roman by International Typesetting and Composition. The art director for the cover was Anthony Landi. Printed and bound by RR Donnelley.

This book is printed on acid-free paper.

McGraw-Hill books are available at special quantity discounts to use as premiums and sales promotions, or for use in corporate training programs. For more information, please write to the Director of Special Sales, McGraw-Hill Professional, Two Penn Plaza, New York, NY 10121-2298. Or contact your local bookstore.
You might be interested in
There are two main items that cause the seasons what are they. There more than one answer
V125BC [204]
What causes the seasons?
The seasons are caused by the tilt of the Earth's rotational axis away or toward the sun as it travels through its year-long path around the sun.
8 0
3 years ago
Why can’t an atom lose or gain a proton
Veronika [31]

Explanation:

Atoms never gain protons; they become positively charge only by losing electrons. A positive ion is called a cation (pronounced: CAT-eye-on). You may have notice that the number of neutrons in each of these ions was not specified.

6 0
3 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
What kind of bond is present in HCI? (Use the electronegativity values from
Snezhnost [94]
The answer is
D. Covalent bond
Hope this helps you have a great day.
8 0
3 years ago
Which of the following is an example of a consumer?
PIT_PIT [208]

Answer:

D. Rabbit

Explanation:

The rabbit is the consumer because he/she (im not judging) will have to consume other plants or small insects to get his/her (again not judging) energy

5 0
3 years ago
Read 2 more answers
Other questions:
  • The vapor pressure of dichloromethane, c h 2 c l 2 , at 0 ∘ c is 134 mmhg . the normal boiling point of dichloromethane is 40. ∘
    5·1 answer
  • In the experiment, you added water to the reaction vessel after the reaction was complete, but we did not discuss why. Based on
    5·1 answer
  • 1. At STP, how many liters of oxygen are required to react completely with 3.6 liters of hydrogen to form water? 2H2(g)+O2(g) -&
    5·1 answer
  • do you guys just sit and answer questions for fun or is it your job because that just sounds lame as shiit. I would like to know
    11·2 answers
  • Hand lotion is what kind of mixture?
    9·1 answer
  • What is the formula or equation for<br><br>motion,speed and energy?
    6·2 answers
  • Identify the trend in bond length of the hydrogen-halide molecule and explain why it exists.​
    13·1 answer
  • -------,-------,--------,and---------- are the four types of main waves
    12·1 answer
  • Why will the conjugate base of a weak acid affect pH? Select the correct answer below: it will react with hydroxide
    12·1 answer
  • Which of the following equations is correctly balanced? UO2(s)+4HF(l)→UF4(s)+H2O(l) NCl3(g)+3H2O(l)→NH3(g)+HClO(aq) 4NH3(g)+3O2(
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!