1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Papessa [141]
3 years ago
9

5. What is another name for Newton’s first law in your own words.

Chemistry
1 answer:
krek1111 [17]3 years ago
5 0
Newton’s first law states that motion stays the same throughout unless changed such as a football being placed on the ground and not moving it stays at rest and the football being thrown stays in motion unless changed by direction.
You might be interested in
Which element had the longest effect on human history?
Dovator [93]
Oxygen I guess :)))       

6 0
2 years ago
True or false <br> The sodium atom becomes a sodium ion with a charge of +1
ddd [48]

Answer:

True

Explanation:

The sodium atom does become a sodium ion with a charge of +1.

6 0
2 years ago
Your body is much larger now than it was when you were a baby. What is the cause of this growth? *
masya89 [10]

Answer:c

Explanation:

4 0
3 years ago
Read 2 more answers
If one were asked to choose between paper or plastic which would be chosen and which one would benefit the environment?
vekshin1
It would be plastic Becaus we can recreate things with plastic and other things that are recyclable. Since,we mostly cut down trees everyday for paper,not knowing that we are wasting natural resources, and destroying animal homes and food.
6 0
3 years ago
Which is associated with a fission reaction? *
podryga [215]

Answer: Radioactive waste

Explanation:

The nuclear fission reaction consists of heavy atomic particles or heavy nucleus, like plutonium and uranium and in radioactive heavy metals. In the fission reaction the nucleus get split into equal masses of particles. This process is associated with release of large amount of energy. The fission of radioactive waste can cause deadly mutations in living beings.      

6 0
3 years ago
Other questions:
  • 5(1-8r)+8r the awnser
    8·2 answers
  • If He(g) has an average kinetic energy of 4790 J/mol under certain conditions, what is the root mean square speed of Cl2(g) mole
    6·1 answer
  • What do many bases have in common
    15·1 answer
  • Steps to clasify a rock?​
    15·1 answer
  • Magbigay ng 3 halimbawa ng lipunang sibil. Paki sagot ng wasto plies &gt;_&lt;​
    8·1 answer
  • Is usually categorized to a specific area in the state known as a soil series
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Identify NaOH (aq) + HNO3(aq) → NaNO3(aq) + H2O(1)
    5·1 answer
  • Which items below are properties of matter? [select all that apply]
    13·1 answer
  • Complete the chemical equations and balance them
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!