1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
5

In the following reaction, what is the effect on the direction of the reaction if more SO3 is added to the reaction mixture?

Chemistry
1 answer:
Stolb23 [73]3 years ago
3 0

Answer:

The equilibrium shifts to produce more reactants.

Explanation:

According to the Le- Chatelier principle,

At equilibrium state when stress is applied to the system, the system will behave in such a way to nullify the stress.

The equilibrium can be disturb,

By changing the concentration

By changing the volume

By changing the pressure

By changing the temperature

Consider the following chemical reaction.

Chemical reaction:

2SO₂ +  O₂  ⇄  2SO₃

In this reaction the equilibrium is disturb by increasing the concentration of Product.

When the concentration of product is increased the system will proceed in backward direction in order to regain the equilibrium. Because when product concentration is high it means reaction is not on equilibrium state. As the concentration of SO₃  increased the reaction proceed in backward direction to regain the equilibrium state and more reactant is formed.

You might be interested in
Help me for brainlest pleaes
Tresset [83]
First option.

The male tails are more attractive because of their long feathers , meanwhile the female tails are shorter than expected!
6 0
3 years ago
An atom of calcium contains 20 protons how many electrons does it have
harina [27]
20.

Atomic number is equivalent to its protons and electrons. :)
4 0
3 years ago
Calculate the ΔG°rxn using the following information at 298K. 2 HNO3(aq) + NO(g) → 3 NO2(g) + H2O(l) ΔG°rxn = ? ΔH°f (kJ/mol) -2
Mkey [24]

Answer:

ΔG°rxn = +50.8 kJ/mol

Explanation:

It is possible to obtain ΔG°rxn of a reaction at certain temperature from ΔH°rxn and S°rxn, thus:

<em>ΔG°rxn = ΔH°rxn - T×S°rxn (1)</em>

In the reaction:

2 HNO3(aq) + NO(g) → 3 NO2(g) + H2O(l)

ΔH°rxn = 3×ΔHfNO2 + ΔHfH2O - (2×ΔHfHNO3 + ΔHfNO)

ΔH°rxn = 3×33.2kJ/mol + (-285.8kJ/mol) - (2×-207.0kJ/mol + 91.3kJ/mol)}

ΔH°rxn = 136.5kJ/mol

And S°:

S°rxn = 3×S°NO2 + S°H2O - (2×S°HNO3 + S°NO)

ΔH°rxn = 3×0.2401kJ/molK + (0.0700kJ/molK) - (2×0.146kJ/molK + 0.2108kJ/molK)

ΔH°rxn = 0.2875kJ/molK

And replacing in (1) at 298K:

ΔG°rxn = 136.5kJ/mol - 298K×0.2875kJ/molK

<em>ΔG°rxn = +50.8 kJ/mol</em>

<em />

7 0
3 years ago
Read 2 more answers
In a titration, the point at which one drop of base turns the acid indicator a pink color that lasts for 30 seconds is called th
xxTIMURxx [149]
The point at which one drop of base turns the acid indicator into a pink color that lasts for thirty seconds in doing titration is called the end point or the equivalence point.

End point or the equivalence point is the one responsible for the pink color that lasts for thirty seconds.
8 0
3 years ago
David walks 10 Km North. He turns East and walks 10 more Km. What is his distance
BigorU [14]

Answer:

20 km

Explanation:

he walks 10 km + another 10 km so 20 :)

3 0
3 years ago
Other questions:
  • Cual de los estados de agregacion es mas abundante en el universo
    5·1 answer
  • given the balanced equation representing a reaction 2NO+O2-&gt;2NO2+energy the mole ratio of NO to NO2 IS
    5·1 answer
  • SOMEONE PLEASE HELP ME!
    14·1 answer
  • URGENT HELP PLEASE balance equation !20 points!
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What does "cells come from other cells" mean?
    11·1 answer
  • 5. Which organelle, found in plant and
    7·1 answer
  • Please answer this. List the three most abundant minerals in this bottle of mineral water.​
    14·1 answer
  • The Earth's Layers
    6·2 answers
  • How do interactions of the biosphere and the geosphere result in ecological succession
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!