1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
10

How test berween nitric and sulferic acid?

Chemistry
1 answer:
steposvetlana [31]3 years ago
7 0
Ba(OH)₂(aq) + 2HNO₃(aq) = Ba(NO₃)₂(aq) + 2H₂O(l)
At the reaction of barium hydroxide with nitric acid there are no visual changes.

Ba(OH)₂(aq) + H₂SO₄(aq) = BaSO₄(s) + 2H₂O
At the reaction of barium hydroxide with sulfuric acid the precipitat of white color is formed.
You might be interested in
Which type of electromagnetic waves are dangerous enough to be used to kill cancerous cells?
Sophie [7]

Answer:

Gamma rays

Since they have high penetrating power.

8 0
2 years ago
Briefly explain what happens to an organism during the process of petrification. Write your answer in the essay box
Aleksandr [31]

Answer:

YOU BETTER GIVE THEM BRAINLEIST ↑↑↑↑↑

Explanation:

4 0
3 years ago
Summarize the relationship between volume, temperature and pressure (use words like “inversely
Alinara [238K]

Answer:

P and V: inversely proportional

P and T: directly proportional

V and T: inversely proportional

Explanation:

For pressure and volume, as the volume goes up, meaning the container gets bigger, the pressure would go down. There would be more room in the container, so there would be less collisions between the molecules themselves and between the molecules and the container. This makes them inversely proportional.

For pressure and temperature, as the pressure goes up, there are more collisions, so the particles move faster. Temperature is the speed of the particles, so, since both pressure and temperature would go up at the same time, they are directly proportional.

For volume and temperature, this is similar to the PV relationship. As volume increases, there are less collisions between the particles. This means that the particles are going to move slower. Therefore, as volume goes up, temperature goes down, so they are inversely proportional.

Sorry this is super long, but I hope it fully explains the question for you! ☺

4 0
3 years ago
Balance this chemical equation. NH4OH AlCl3 → Al(OH)3; NH4Cl
skad [1K]
3NH4OH+AlCl3=Al(OH)3+3NH4Cl
7 0
3 years ago
Read 2 more answers
Chloroform flows through a 4.26 inch inside-diameter pipe at the rate of 3.60 gallons per minute. What is the average velocity o
Pani-rosa [81]

Answer:

1) 0,081 ft/s

2) 0,746 lb/s

Explanation:

The relation between flow and velocity of a fluid is given by:

Q=Av

where:

  • Q, flow [ft3/s]
  • A, cross section of the pipe [ft2]
  • v, velocity of the fluid [ft/s]

1)

To convert our data to appropiate units, we use the following convertion factors:

1 ft=12 inches

1 ft3=7,48 gallons

1 minute=60 seconds

So,

Q=\frac{3,60 gallons}{1 min}*\frac{1min}{60 s}*\frac{1ft3}{7,48gallons}=0,00802 \frac{ft3}{s}

As the pipe has a circular section, we use A=πd^2/4:

d=4,26 inch *\frac{1ft}{12 inch}=0,355ft\\  A=\pi \frac{0,355^{2} }{4}=0,0989ft2

Finally:

Q=vA......................v=Q/A

v=\frac{0,00802ft^{3} /s}{0,0989ft^{2} }=0,081ft/s

2)

The following formula is used to calculate the specific gravity of a material:

SG = ρ / ρW  

where:

  • SG = specific gravity,
  • ρ = density of the material [lb/ft3]
  • ρW = density of water [lb/ft3] = 62.4 lbs/ft3

then:

ρ = SG*ρW   = 1,49* 62,4 lb/ft3 = 93 lb/ft3

To calculate the mass flow, we just use the density of the chloroform in lb/ft3 to relate mass and volume:

0,00802 \frac{ft3}{s}*\frac{93lb}{1ft3}=0,746lb/s

7 0
3 years ago
Other questions:
  • White light has no color.<br> False<br> True<br> Or false
    7·1 answer
  • The half-life is the amount of time it takes for one-half of an isotope sample to decay into a different element. The half-life
    11·1 answer
  • A solution containing sodium fluoride is mixed with one containing calcium nitrate to form a solution that is 0.015M in NaF and
    7·1 answer
  • What is the pOH of a solution that has a OH - concentration equal to 1.3x 10^-10
    8·2 answers
  • How is radiation measured? (1 PowerPoint )
    10·2 answers
  • Of the following equilibria, only ________ will shift to the right in response to a decrease in volume. N2 (g) + 3H2 (g) 2NH3 (g
    7·1 answer
  • Select all the correct answers.
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of the liquids you tested (isopropyl alcohol, water, and glycerol) displayed the greatest surface tension (greatest interm
    5·1 answer
  • The theoretical yield of zinc oxide in a reaction is 486 g. what is the percent
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!