1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
2 years ago
10

How test berween nitric and sulferic acid?

Chemistry
1 answer:
steposvetlana [31]2 years ago
7 0
Ba(OH)₂(aq) + 2HNO₃(aq) = Ba(NO₃)₂(aq) + 2H₂O(l)
At the reaction of barium hydroxide with nitric acid there are no visual changes.

Ba(OH)₂(aq) + H₂SO₄(aq) = BaSO₄(s) + 2H₂O
At the reaction of barium hydroxide with sulfuric acid the precipitat of white color is formed.
You might be interested in
"An increase in the price of gasoline will increase the demand for hybrid vehicles." This statement is an example of a positive
-Dominant- [34]

Answer:

True

Explanation:

This is because the statement above fits the definition of a positive economic statement. A Positive economic statement refers to objective statements that can be verified, tested , amended or discarded by consulting available evidence .The statement above can be tested objectively to establish its veracity.

3 0
3 years ago
What are some visible signs of an acid-base reaction?
marta [7]
I think one of the signs is <span>water and  salt are formed 

</span>
6 0
3 years ago
The ratio of boys to girls at a school
Marat540 [252]

Answer:

Si tú puedes 1-2-3-4-5-6-7-8-9-10 eso debes de ser más bien dicho sacaran Club Ojalá que te ayude Chau

Explanation:

de Ojalá que te ayude No te olvides de sacar todas las preguntas esas lo que tú dijiste y si tú promoción 123 saquen globo que quieras tú

5 0
3 years ago
If an acid or alkali is diluted by a factor of 10, what effect will this have on its pH?
Alisiya [41]

Answer: When an acidic solution is diluted with water the concentration of H + ions decreases and the pH of the solution increases towards 7.

Explanation:

5 0
2 years ago
Which is larger? C atom or F atom? Explain why.
tekilochka [14]

Answer:

Carbon or Fleuronie?

Explanation:

3 0
2 years ago
Other questions:
  • can someone please help me ill mark brainliest and lots of points please help me someone that likes helping people please help m
    15·2 answers
  • A 8.00g of a certain Compound X, known to be made of carbon, hydrogen and perhaps oxygen, and to have a molecular molar mass of
    5·1 answer
  • Durning a tornado you should get to anything except for
    6·1 answer
  • ANDRES MEJIA-C...
    11·1 answer
  • Can someone please explain this to me t,t
    8·1 answer
  • How many molecules are there in 35 grams of FeF3?​
    11·1 answer
  • What kind of energy is produced from moving water?
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What is the hydrogen ion concentration of oven cleaner?
    14·1 answer
  • How does it? Please help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!