1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
4 years ago
12

Write the electron dot structures for the following elements:

Chemistry
1 answer:
Evgesh-ka [11]4 years ago
7 0

Answer:

Drawings of Lewis structure Are attached for your elements

Explanation:

Please open the attachment

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
From what are chemical sedimentary rocks formed?
masha68 [24]
Chemicals dissolved in water. Calcite is a good example, if I'm not mistaken.
6 0
3 years ago
Read 2 more answers
37.9 grams of an unknown substance undergoes a temperature increase of
jenyasd209 [6]

Answer:

1.023 J / g °C

Explanation:

m = 37.9 grams

ΔT = 25.0*C

H = 969 J

c = ?

The equation relating these equation is;

H = mcΔT

making c subject of formulae;

c = H / mΔT

c = 969 J / (37.9 g * 25.0*C)

Upon solving;

c = 1.023 J / g °C

4 0
3 years ago
How do atmospheric updrafts affect clouds?
Andru [333]

Answer:

Updrafts characterize a storm's early development, during which warm air rises to the level where condensation begins and precipitation starts to develop. In a mature storm, updrafts are present alongside downdrafts caused by cooling and by falling precipitation.

Hope it helps  

Have a great Day : P

6 0
3 years ago
Consider these reactions:
Virty [35]

511.2 grams of chlorine gas consumed (with excess H-) when

1,342.0 kJ of energy is released from the system.

<h3></h3><h3>What is an exothermic reaction?</h3>

In thermochemistry, an exothermic reaction is a "reaction for which the overall standard enthalpy change ΔH⚬ is negative."

Given that 1 mole of chlorine releases -184.6 energy.

Then, we have to find the number of moles of chlorine when 1,342.0 kJ of energy is released from the system.

So, calculating number of moles of chlorine.

Moles = \frac{-1,342.0 \;kJ}{-184.6\;kJ}

Moles = 7.2 mole

Now, calculating number mass of chlorine.

\rm Moles=\rm\frac{Mass}{Molar \;mass}

Mass =  7.2 mole x 71 g/mole

Mass = 511.2 gram

Learn more about exothermic reaction here:

brainly.com/question/10373907

#SPJ1

3 0
3 years ago
Other questions:
  • Could you please Calculate the number of atom of 40K (potassium 40) in 1gram of KCl. Taking into account the isotopic abundance
    7·1 answer
  • The mass of amu of 710 iron atoms
    5·1 answer
  • A lead atom has a mass of 3.14 x 10 to the negative 22nd g.How
    10·1 answer
  • Determine the name of the following compound Fe(OH) 3 , Provide explanation of how you determined the name, including the type o
    13·1 answer
  • What can form as a result of a chemical reaction?
    9·2 answers
  • Scott is trying to choose between two doctor offices and gets a distribution from each one that shows the number of minutes a
    6·1 answer
  • What can experiments in a lab tell us about substances on Titan?
    11·1 answer
  • What is PO3 compound name?
    6·1 answer
  • How Chemistry and Earth Science are Connected?Can you tell me completely?​
    15·1 answer
  • Except for speed, your nervous system is most similar to
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!