1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anzhelika [568]
3 years ago
7

The tuition costs, C, for a local community college are modeled by C(h) = 250 + 200h, where h represents the number of credit ho

urs taken. The local state university has tuition costs, S, modeled by the function S(h) = 300 + 180h. How many credit hours will a student have to take for the two tuition costs to be equal? Round the answer to the nearest tenth of an hour. 250 + 200h = 300 + 180h 250 + 200h = 300 + 180h − 180h − 180h 250 + 20h = 300 h = credit hours
Mathematics
2 answers:
Paladinen [302]3 years ago
5 0
To solve how many credit hours will a student have to take for the two tuition costs to be equal, the two functions should be equated and solve for the number of hours
  C (h) = S (h)
250 + 200h = 300 + 180h
200h – 180h = 300 – 250
20h = 50
<span>H = 2.5 credit hours</span>
Keith_Richards [23]3 years ago
4 0

Answer:

The answer is 2.5 credit hours.

Step-by-step explanation:

The answer is so simple you don't need explanation

‍♀️

You might be interested in
HELP MEEEEEEEE PMEASE<br> In order!!!
Tasya [4]

Step-by-step explanation:

The value of all the angles in a triangle add up to 180.

So to find x do 180-(66+52)

The angle opposite of x is the same value as x

X+E or X+Z are both equal to 180.

3 0
3 years ago
Divide x^4+7 by x-3 <br><br>A) 3x^3+3x^2+9x-27 <br>B) 3x^3+3x^2+9x+27<br>C)x^3+3x^2+9x+27
Ksju [112]
X^4 / x = x^3 so the answer cant be A or B 

Must be C
4 0
3 years ago
Read 2 more answers
Plz help ASAP thanks! <br><br><br> Image^^
Reptile [31]

The answer to this question is B.

6 0
3 years ago
Read 2 more answers
Help me pleaeeeeeerr!!!!!!
anygoal [31]

Answer:

A = 4/5 ft

Step-by-step explanation:

Area = length x width

A = 2 2/5 x 1/3

Turn the mixed number into an improper fraction:

2 2/5 = 12/5

A = 12/5 x 1/3

A = 12/15

You can divide the top and bottom by 3:

A = 4/5

8 0
3 years ago
Read 2 more answers
The volume of a cylinder with height h and radius r can be found using this formula
Eddi Din [679]

I have solved this problem in given picture

8 0
3 years ago
Other questions:
  • Which of the following inequalities are true A.10 &lt; 9, B. 9 &lt; 10, C. 10 &gt; 9, D. 9 (is less than or equal to ) 10
    7·1 answer
  • F(x)=13x-14<br> Find the domain of f(x)
    11·1 answer
  • X/-9 ​≥ 3
    9·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How to solve x/3 + 4 = -2
    10·2 answers
  • Find the sum of the interior angles of a regular 32-gon. Then find the measure of each angle.
    8·1 answer
  • how could we graphically visualize the relationshio between the age of a used car and the selling price if a used car
    13·1 answer
  • -95, -17,-60-90, 67, 74, 27, 70
    12·1 answer
  • Examine the rotation. Which best describes point D?
    7·2 answers
  • A group that was given immigration priority under the Immigration Act of 1965
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!