1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
3 years ago
12

A cheetah can go from a state of resting to running at 20 m/s in just two seconds. What is the cheetah's average acceleration?

Chemistry
1 answer:
soldier1979 [14.2K]3 years ago
8 0

Answer:

D is answer ..... !!!!!!!!.......!!!!!!#.#.....

You might be interested in
A buffer solution contains 0.345 M acetic acid and 0.377 M sodium acetate . If 0.0613 moles of potassium hydroxide are added to
melamori03 [73]

Answer:

pH = 5.54

Explanation:

The pH of a buffer solution is given by the <em>Henderson-Hasselbach (H-H) equation</em>:

  • pH = pKa + log\frac{[CH_3COO^-]}{[CH_3COOH]}

For acetic acid, pKa = 4.75.

We <u>calculate the original number of moles for acetic acid and acetate</u>, using the <em>given concentrations and volume</em>:

  • CH₃COO⁻ ⇒ 0.377 M * 0.250 L = 0.0942 mol CH₃COO⁻
  • CH₃COOH ⇒ 0.345 M * 0.250 L = 0.0862 mol CH₃COOH

The number of CH₃COO⁻ moles will increase with the added moles of KOH while the number of CH₃COOH moles will decrease by the same amount.

Now we use the H-H equation to <u>calculate the new pH</u>, by using the <em>new concentrations</em>:

  • pH = 4.75 + log\frac{(0.0942+0.0613)mol/0.250L}{(0.0862-0.0613)mol/0.250L} = 5.54
6 0
3 years ago
Which of the following is a statement of Hess's law?
attashe74 [19]

Answer:

C

Explanation:

the enthalpy of reaction is independent of the reaction path

7 0
3 years ago
Which of the following pairs consists of a weak acid and a strong base? (1 point)
notka56 [123]

Answer:

acetic acid, sodium hydroxide

Explanation:

A strong acid is an acid that ionizes in water to give all its hydrogen ion. Weak acid only ionize to a certain degree. Acetic acid (CH3COOH) only ionize to give one hydrogen ion despite having other hydrogen atom. This account for its weak nature as an acid as shown below:

CH3COOH <=> H^+ + CH3COO^-

A strong base is a base that ionizes in water to give all it hydroxide ion. Sodium hydroxide(NaOH) ionizes to give all its hydroxide ions. This make it a strong base as shown below;

NaOH <=> Na^+ + OH^-

8 0
3 years ago
How is the behavior of electrons in an ionic bond different from the behavior of electrons in a covalent bond?
Valentin [98]

Answer:

The correct answer is "Electrons are transferred in an ionic bond"

Explanation:

The covalent bond is the chemical bond between atoms where electrons are shared, forming a molecule. Covalent bonds are established between non-metallic elements, such as hydrogen H, oxygen O and chlorine Cl. These elements have many electrons in their outermost level (valence electrons) and have a tendency to gain electrons to acquire the stability of the electronic structure of noble gas. The shared electron pair is common to the two atoms and holds them together.

An ionic bond is produced between metallic and non-metallic atoms, where electrons are completely transferred from one atom to another. During this process, one atom loses electrons and another one gains them, forming ions. Usually, the metal gives up its electrons forming a cation to the nonmetal element, which forms an anion.

In conclusion, chemical bonds are made so that atoms can have their entire outer layer, and thus have a stable electronic configuration. In the ionic bond, when the metallic atom has only one electron in its outer layer and the non-metallic one needs an electron to complete its layer; The metallic atom seats its electron to the non-metallic one. In the same way, the electron is shared in the covalent bond in order to achieve equilibrium.  

Then, the main differences between the two bonds are that the ionic bond occurs between two different atoms (metallic and non-metallic), while the covalent bond occurs between two equal atoms (non-metallic). And in the covalent bond there is an electron compartment, while in the ionic bond there is an electron transfer.

So, the correct answer is "Electrons are transferred in an ionic bond"

8 0
3 years ago
Read 2 more answers
What is the frequency of a wave with a wavelength of 6.40x10^4 meters?
yKpoI14uk [10]

Answer:

frequency = 0.47×10⁴ Hz

Explanation:

Given data:

Wavelength of wave = 6.4× 10⁴ m

Frequency of wave = ?

Solution:

Formula:

Speed of wave = wavelength × frequency

Speed of wave = 3 × 10⁸ m/s

Now we will put the values in formula.

3 × 10⁸ m/s = 6.4× 10⁴ m × frequency

frequency = 3 × 10⁸ m/s / 6.4× 10⁴ m

frequency = 0.47×10⁴ /s

s⁻¹ = Hz

frequency = 0.47×10⁴ Hz

Thus the wave with wavelength of 6.4× 10⁴ m have 0.47×10⁴ Hz frequency.

4 0
3 years ago
Read 2 more answers
Other questions:
  • What happens in nuclear fusion?
    8·2 answers
  • How is geometrical symmetry related to the polarity of a molecule?
    11·2 answers
  • Which pack has the greatest change in enthalpy, warm packs (such as hand warmers) or cold packs (such as an ice pack)?
    5·1 answer
  • Arrange the following elements in order of increasing (from smallest to largest) atomic size: H, Br, Cl, O. Explain the reasonin
    8·1 answer
  • Which predictions can most likely be made?
    11·2 answers
  • How many electrons are in the outermost energy level of a neutral<br> strontium atom?*
    12·1 answer
  • What happens when the pressure of a gas is decreased?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How many moles of ammonia are produced by 5 moles of hydrogen.
    12·1 answer
  • Which inner planet has 2 moons? Question 2 options: Mercury Venus Earth Mars
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!