1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
3 years ago
8

Can someone help me solve this? I was given the answer at the end of class but I don't understand how the teacher got it. (Direc

tions: Balance each redox reaction in acid solution using the half reaction method.)
PbO2+I2=>Pb^2+ +IO3^- = I2+8H^+ +5PbO2=>2IO3^- +5Pb^+2 +4H2O
Chemistry
1 answer:
KiRa [710]3 years ago
8 0
Unbalanced chemical reaction: PbO₂ + I₂ → Pb²⁺ +IO₃⁻<span>.
First </span><span>determine oxidation numbers of elements:
1) lead on the left side of reaction has oxidation number +4 (x + 2</span>·(-2) = 0) and on the right side +2, so lead is reduced.
2) iodine has neutal charge (0) on left and oxidation number +5 on the right side of chemical reaction (x + 3 · (-2) = -1), so iodine is oxidized.
3) oxygen has oxidation number -2 on both side of chemical reaction.
Second, write balanced half reactions, because this reaction is acidic solution, add hydrogen ions on one side and water on another side of half reaction; balance atoms and electrons on both half reactions:
Half reaction 1: PbO₂ + 4H⁺ + 2e⁻ → Pb²⁺ + 2H₂O /×5
5PbO₂ + 20H⁺ + 10e⁻ → 5Pb²⁺ + 10H₂O.
Half reaction 2: I₂ + 6H₂O → 2IO₃⁻ + 12H⁺ + 10e⁻.
Sum both half reactions and short same ions: 
5PbO₂ + 20H⁺ + I₂ + 6H₂O → 5Pb²⁺ + 10H₂O + 2IO₃⁻ + 12H⁺.
Abbreviate reaction: 5PbO₂ + 8H⁺ + I₂  → 5Pb²⁺ + 4H₂O + 2IO₃⁻..
You might be interested in
If you have 100 ml of a 0.10 m tris buffer (pka 8.3) at ph 8.3 and you add 3.0 ml of 1.0 m hcl, what will be the new ph?
sukhopar [10]

The new pH is 7.69.

According to Hendersen Hasselbach equation;

The Henderson Hasselbalch equation is an approximate equation that shows the relationship between the pH or pOH of a solution and the pKa or pKb and the ratio of the concentrations of the dissociated chemical species. To calculate the pH of the buffer solution made by mixing salt and weak acid/base. It is used to calculate the pKa value. Prepare buffer solution of needed pH.

                       pH = pKa + log10 ([A–]/[HA])

Here, 100 mL  of  0.10 m TRIS buffer pH 8.3

                 pka = 8.3

         0.005 mol of TRIS.

∴  8.3 = 8.3 + log \frac{[0.005]}{[0.005]}

<em>    </em>inverse log 0 = \frac{[B]}{[A]}

   \frac{[B]}{[A]} = 1

Given; 3.0 ml of 1.0 m hcl.

           pka = 8.3

           0.003 mol of HCL.

pH = 8.3 + log \frac{[0.005-0.003]}{[0.005+0.003]}\\pH = 8.3 + log \frac{[0.002]}{[0.008]}\\\\pH = 8.3 + log {0.25}\\\\pH = 8.3 + (-0.62)\\pH = 7.69

Therefore, the new pH is 7.69.

Learn more about pH here:

brainly.com/question/24595796

#SPJ1

 

8 0
2 years ago
True or false: plants, animals, and the environment are not dependent on each other for the use of carbon and oxygen.
Reil [10]
False; animals breathe in oxygen and they produce carbon dioxide when they breathe out, and plants breathe in that carbon dioxide that the animals produce, and with that the plants create oxygen

They basically just swap oxygen for CO2, or CO2 for oxygen! So the answer is false because they DO depend on each other for the use of Oxygen and Carbon dioxide! Hope this helped :)
7 0
3 years ago
Ethane is an alkane having two carbon atoms bound to hydrogen atoms. Recall what you have learned about the tetravalent nature o
svlad2 [7]
The molecule for ethane is C2H6. or CH3-CH3. 

Carbon LOVES hydrogen. If possible, Carbon would have four bonds attach to hydrogens. IN this molecule, one of the bond is used to attach a carbon to another carbon, so instead of 4 hydrogens, each carbon would have 3 hydrogens..
3 0
3 years ago
The carbon atoms in graphite and the carbon atoms in diamond have different
kicyunya [14]

Answer:

<u>structural arrangements</u>

_______________________________________

<h2>properties of daimond: </h2><h3>appearance: transparent</h3><h3>hardness: very hard</h3><h3>thermal conductivity :very poor</h3><h3>electric conductivity: poor</h3><h3>density:</h3>

3510 {kgm}^{3}

<h3>uses: jewellery and drilling</h3>

_______________________________________

<h2>properties of graphite:</h2>

<h3>appearance: black shiny</h3><h3>hardness: soft ,slippery to touch</h3><h3>thermal conductivity : moderate</h3><h3>electric conductivity: good</h3><h3>density:</h3>

2250 {kgm}^{3}

<h3>uses:dry cell, electric arc, pencil lead, lubricant</h3>

_______________________________________

<h2>How Diamond and Graphite are chemically identical?</h2>
  • On heating diamond or graphite in the air, they burn completely to form carbon dioxide.
  • - Equal quantities of diamond and graphite when burned, produce exactly the same amount of carbon dioxide.

_______________________________________

<h2>Why the physical properties of diamond and graphite are so different?</h2>

Due to the difference in the arrangement of carbon atoms in diamond and graphite

_______________________________________

<h2><em><u>hope</u></em><em><u> it</u></em><em><u> helps</u></em><em><u> you</u></em><em><u><</u></em><em><u>3</u></em></h2>

7 0
2 years ago
How many electrons are in Hydrogen?
KonstantinChe [14]
1. Hydrogen has 1 electron.
5 0
3 years ago
Read 2 more answers
Other questions:
  • How can a charged atom (an ion) attract a neutral atom? 1. the charged atom can hit the neutral atom and make it positively char
    14·1 answer
  • How do you solve for the Atomic Mass in chemistry?
    7·2 answers
  • What do you call material formed by weathering that is then eroded and deposited
    9·1 answer
  • Will mark Brainliest
    13·2 answers
  • What metric measurement is similar to a mile?
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 4Al + 3O2 → 2Al2O3
    9·2 answers
  • What’s the answer to this question
    13·1 answer
  • When do you use 6.02*10^23?? Do you use it when going to atoms or molecules????
    8·1 answer
  • Which energy changes are associated with a liquid boiling?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!