1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
7

How to convert 35ml= dl

Chemistry
1 answer:
Nata [24]3 years ago
6 0

okay so, 35ml = 0.35 dl.

"We know (by definition) that: 1⁢ml ≈ 0.01⁢dl

We can set up a proportion to solve for the number of deciliters.

1⁢ml35⁢ml ≈ 0.01⁢dlx⁢dl

Now, we cross multiply to solve for our unknown x:

x ⁢ dl ≈ 35⁢ml1⁢ml * 0.01 ⁢ dl → x ⁢ dl ≈ 0.35000000000000003 ⁢ dl

Conclusion: 35 ⁢ ml ≈ 0.35000000000000003 ⁢ dl"

website used: https://converter.ninja/volume/milliliters-to-deciliters/35-ml-to-dl/

You might be interested in
Carbon dioxide is a colorless odorless gas why is it considered a pollutant?
WARRIOR [948]

Carbon dioxide is a gas having chemical formula CO_{2}, a gas which exhaled by humans and inhaled by plants. It is also emitted from the sources such as cement production and combustion of fossil fuels. It is also known as greenhouse gas associated with acidification of ocean.

Carbon dioxide with other gases acts like a blanket of Earth which absorbs infrared radiations emitted from the sun and thus, preventing the escaping of these rays into the outer space which results in the gradual heating of Earth's surface and atmosphere i.e. increase in temperature of Earth. This process is known as Global Warming.

Hence, carbon dioxide is responsible for the increase in warming of the atmosphere i.e. option (D).



7 0
4 years ago
Read 2 more answers
An iron chloride compound contains 55.85 grams of iron and 106.5 grams of chlorine. What is the most likely empirical formula fo
mart [117]

Answer:

FeCl_{3}

Explanation:

Moles =\frac {Given\ mass}{Molar\ mass}

mass of Fe = 55.85 g

Molar mass of Fe = 55.85 g/mol

<u>Moles of Fe = 55.85 / 55.85 = 1</u>

mass of Cl = 106.5 g

Molar mass of Cl = 35.5 g/mol

Moles of Cl = 106.5 / 35.5 = 3

Taking the simplest ratio for Fe and Cl as:

1 : 3

The empirical formula is = FeCl_{3}

3 0
3 years ago
`You have to be careful about pouring drano down your pipes since it is mainly hydrochloric acid--you can't do it if they are ma
Zanzabum

Answer:

6.67 moles

Explanation:

Given that:-

Moles of hydrogen gas produced = 10.0 moles

According the reaction shown below:-

2Al + 6HCl\rightarrow 2AlCl_3 +3H_2

3 moles of hydrogen gas are produced when 2 moles of aluminium undergoes reaction.

Also,

1 mole of hydrogen gas are produced when \frac{2}{3} moles of aluminium undergoes reaction.

So,

10.0 moles of hydrogen gas are produced when \frac{2}{3}\times 10.0 moles of aluminium undergoes reaction.

<u>Moles of Al needed  = \frac{2}{3}\times 10.0 moles = 6.67 moles</u>

6 0
3 years ago
what volume of hydrogen gas is evolved from a reaction between 0.52 g of Na and water? This gas is collected at 20 C and 745mmHg
guapka [62]
The  volume of  hydrogen  gas  that evolved  is   calculated  as  follows
by  use  of   ideal  gas  equation

that  is  PV = nRT
P=745  mm hg
V= ?
R(gas  constant)= 62.36 L.mm hg/mol.k
T= 20 + 273 = 293 k
n=number  of  moles which is calculated as  follows
find the  moles  of Na  used
= 0.52/23=0.023  moles

write the reacting equation
2Na +2H2O =2NaOH +H2
by  use  of reacting  ratio  between  Na : H2  which  is  2:1  therefore  the mole  of H2 = 0.023/2 =0.0115  moles

by  making  the  volume  the   subject  of  the formula
v=nRT/P
V= (0.0115 x 62.36  x 293) / 745  = 0.283 L


6 0
3 years ago
How many neutrons dose O^-2 have
ElenaW [278]
Oxygen is the 8th element in the periodic table. This means that oxygen has 8 protons<span> and 8 electrons. In order to get the number of neutrons you take the atomic weight in this case 15.9999~16 and you subtract it by the number of protons (16-8) (o_O)

</span>
8 0
3 years ago
Other questions:
  • In two or more complete sentences explain how to balance the chemical equation, KClO3 ⟶ KCl + O2 and include all steps. Write yo
    15·1 answer
  • For the reaction 2 HCl + Na2CO3 → 2 NaCl + H2O + CO2 8.0 moles of CO2 is collected at STP. What is the volume of CO2? 1. 57.6 L
    5·1 answer
  • Why are tadpoles susceptible to disease during metamorphasis
    6·2 answers
  • During an experiment, solid iodine was placed in a sealed container. The container was gradually heated and purple-colored vapor
    9·2 answers
  • You have 125 g of a certain seasoning and are told that it contains 70.0 g of salt. What is the peroentage of salt by mass in th
    6·2 answers
  • I need help with #3 name the compound
    14·1 answer
  • What happens in a stationary front?
    6·1 answer
  • How many electrons can the fourth energy level can accommodate? a.2 b.8 c.16 d.32​
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Let's Evaluate Complete the table below by giving the solute and the solvent of the given types and examples of solution.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!