All categories

3 years ago

An organic compound in which a carbonyl group is bonded to two different carbon atoms is a(n) amide. aldehyde. ketone. ester.

2 answers:

4 0

An organic compound in which a carbonyl group is bonded to two different carbon atoms is a ketone. The ketones are organic compounds in which a carbonyl group (C=O) is bonded to two carbon atom. A carbonyl group is a carbon-oxygen double bond. Ketones are of great importance in industry and in biology, <span>as solvents, polymer precursors, and pharmaceuticals.</span>

Anton [14]3 years ago

3 0

Answer: ketone

Explanation:

Functional groups are specific group of atoms within molecules that are responsible for the characteristic chemical reactions of those molecules.

1. Amides have functional group $-O=C-NH_2$ .

Example: Ethanamide with molecular formula $CH_3CONH_2$

2. Aldehydes have functional group $-O=CH$ .

Example: Ethanal with molecular formula $CH_3CHO$

3. Ketones have functional group $-C=O$ .

Example: Propanone with molecular formula $CH_3COCH_3$

4. Esters have functional group $-O=C-OR$ .

Example: methyl ethanoate with molecular formula $CH_3COOCH_3$

You might be interested in

SeF6 1. Lewis Structure 2. Perspective drawing 3. Number of atoms bonded to central atom 4. Number of non-bonding electron pairs

Anarel [89]

The answer is- $SF_{6}$ is octahedral in electronic and molecular geometry with 6 Fluorine atoms bonded to central atom S.

Lewis structures are the diagrams in which the valence electrons of the atoms of a compound are arranged around the atoms showing the bonding between the atom and the lone pair of electrons existing in the molecule.

Determine the molecular geometry of $SF_{6}$ .

Valence Shell Electron Pair Repulsion theory is commonly known as VSEPR theory and it helps to predict the geometry of molecules.
According to this theory, electrons are arranged around the central atom of the molecule in such a way that there is minimum electrostatic repulsion between these electrons.
Now, calculate the total number of valence electrons in $SF_{6}$ .

$Valence\ electrons\ in\ SF_{6}= Valence\ electrons\ in\ S +\ 6(Valence\ electrons\ in\ F)$

Valence electrons of S = 6

Valence electrons of F = 7

Thus, the valence electrons in $SF_{6}$ are-

$Valence\ number\ of\ electrons\ in\ SF_{6} = (6) + 6(7) = 48\ electrons.$

The Lewis structure of $SF_{6}$ is - (Image attached).
In the structure, the number of atoms bonded to central atom (S) = 6.
Number of non-bonding electron pairs on the central atom = 0 (as all the valence electrons are bonded to F).
Electronic geometry in case of 6 bond pairs is octahedral.
Molecular geometry us also octahedral with bond angles 90°.
Central atom is sp3d2 hybridised.
$SF_{6}$ is a non-polar molecule.

To learn more about Lewis structures visit:

brainly.com/question/12307841?referrer=searchResults

#SPJ4

7 0

1 year ago

What principle chemistry

NNADVOKAT [17]

Is this a question ?

8 0

3 years ago

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message

Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0

3 years ago

Use the exponential term in the Arrhenius equation to explain how temperature affects reaction rate.

WINSTONCH [101]

The Arrhenius equation describes the relation between the rate of reaction and temperature for many physical and chemical reactions

It is an expression that provides a relationship between the rate constant (of a chemical reaction), the absolute temperature.

The Arrhenius equation,

k = $zpe^{\frac{- Ea}{RT} }$ , where

k is the rate constant,

z is the collision factor,

p is the steric factor,

Ea is the activation energy,

R = 8.3245 $\frac{J}{mol. K}$ is the ideal gas constant, and,

T is the temperature.

The activation energy by definition, is the minimum energy (or threshold energy) required for two particles of reactants upon collision to form products.

The Arrhenius equation could also be written as:

⇒ k = $Ae\frac{-Ea}{RT}$ , where

⇒ A = zp, the Arrhenius factor.

Taking the neutral logarithm of both parties, we get:

⇒ In k = $\frac{-Ea}{RT}\frac{(1)}{(T)}$ + In A,

Assuming that, A is independent of temperature, when T is increased, the equilibrium constant k will also increase and therefore, the rate of the reaction will also increase.

To learn more about Arrhenius equation here

brainly.com/question/9786461

#SPJ4

6 0

2 years ago

Suppose 6.63g of zinc bromide is dissolved in 100.mL of a 0.60 M aqueous solution of potassium carbonate. Calculate the final mo

Alenkasestr [34]

Answer:

[Zn²⁺] = 4.78x10⁻¹⁰M

Explanation:

Based on the reaction:

ZnBr₂(aq) + K₂CO₃(aq) → ZnCO₃(s) + 2KBr(aq)

The zinc added produce the insoluble ZnCO₃ with Ksp = 1.46x10⁻¹⁰:

1.46x10⁻¹⁰ = [Zn²⁺] [CO₃²⁻]

We can find the moles of ZnBr₂ added = Moles of Zn²⁺ and moles of K₂CO₃ = Moles of CO₃²⁻ to find the moles of CO₃²⁻ that remains in solution, thus:

<em>Moles ZnB₂ (Molar mass: 225.2g/mol) = Moles Zn²⁺:</em>

6.63g ZnBr₂ * (1mol / 225.2g) = 0.02944moles Zn²⁺

<em>Moles K₂CO₃ = Moles CO₃²⁻:</em>

0.100L * (0.60mol/L) = 0.060 moles CO₃²⁻

Moles CO₃²⁻ in excess: 0.0600moles CO₃²⁻ - 0.02944moles =

0.03056moles CO₃²⁻ / 0.100L = 0.3056M = [CO₃²⁻]

Replacing in Ksp expression:

1.46x10⁻¹⁰ = [Zn²⁺] [0.3056M]

4 0

3 years ago