1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TEA [102]
3 years ago
15

Which event is an example of a contact force?

Chemistry
1 answer:
Alborosie3 years ago
6 0

Answer: D. A person pulling a sled

Explanation:

A contact force is any force that requires contact/touch to occur, such as kicking, pulling, or pushing something.

You might be interested in
What type of particle is emitted by each type of radioactive decay?
olya-2409 [2.1K]

C. alpha = nucleus of a helium atom

beta = electron

gamma = photon

4 0
3 years ago
Read 2 more answers
What is the product of the unbalanced equation below?
Stolb23 [73]

Answer:

D

Explanation:

The answer is D. I'm not sure that it is a solid. I don't think it is a ppte, which is the only way it can be a true solid. It is ionic if the reaction is taking place in water and there is someway to start the reaction. Be that as it may, the internal balace numbers of the chemical produced is the only possible answer. The balanced eq;uatioon is

2Al + 3Br2 ==> 2AlBr3

3 0
3 years ago
HELP 10pts!
masha68 [24]

IM IN THAT CLASS TOO

Im abt to do it and ill send u all the answers when im

done, add me on sxxap or instaxxxgram so i can send it to u

my userneamen both: Bellaberrygood

5 0
3 years ago
Heat energy is _____ when it moves from one room to another.
MArishka [77]
Hello,

Thanks for posting your question here on brainly.

There are 3 ways heat energy can move:<span> Radiation, conduction, and convection.
</span>
However, your answer to this is most likely conduction

hope this helps:)

please let me know if it's correct.



6 0
3 years ago
John recently purchased a High Definition plasma television and needed to have it installed. The installers told John that for t
ioda
Ductility - a materials ability to stretch, ie if you pull it apart does it stretch to a wire.

density - ratio of volume to mass

conductivity - materials ability to conduct a current.

hopefully with these definitions you can figure out the answer.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Convert 7.680 moles of PtSe to grams
    15·1 answer
  • The antibiotic doxycycline is used to treat Lyme disease. A 100 mg dose of the antibiotic consists of 59.5 mg of C, 5.40 mg of H
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following processes can be used to determine the instantaneous reaction rate for nitrogen monoxide (NO) at a specif
    9·1 answer
  • A 6.175 gram sample of an organic compound containing only C, H, and O is analyzed by combustion analysis and 13.30 g CO2 and 5.
    14·1 answer
  • Which of the following safety devices ensures that electricity will flow through it when flowing "downhill" instead of through p
    9·2 answers
  • What is the molarity of a solution that has 2.52 grams of NaCO3 dissolved to
    9·1 answer
  • When you add an inert gas, the reaction
    12·1 answer
  • Data and evidence are interchangeable in science. True or false?
    14·1 answer
  • HELP PLEASE!!! Which of the following best describes the nitrogen fixation process?(1 point) Producers convert nitrogen gas into
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!