How many valence electrons does strontium (Sr) have?

What is meant by the term specific heat?

Alex73 [517]

Answer:

the heat required to raise the temperature of the unit mass of a given substance by a given amount (usually one degree).

8 0

3 years ago

Answer fast my H.W is hard

Marina86 [1]

<u>Answer:</u> The molality of $MgF_2$ solution is 4.013 m

<u>Explanation:</u>

Molality is defined as the amount of solute expressed in the number of moles present per kilogram of solvent. The units of molarity are mol/kg.

The formula used to calculate molarity:

.....(1)

Given values:

Given mass of $MgF_2$ = 20.0 g

Molar mass of = 62.3 g/mol

Mass of solvent = 80.0 g

Putting values in equation 1, we get:

$\text{Molality of }MgF_2=\frac{20.0\times 1000}{62.3\times 80.0}\\\\\text{Molality of }MgF_2=4.013m$

Hence, the molality of $MgF_2$ solution is 4.013 m

3 0

3 years ago

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0

3 years ago

Butane C4H10 (g),(Hf = –125.7), combusts in the presence of oxygen to form CO2 (g) (Delta.Hf = –393.5 kJ/mol), and H2O(g) (Delta

shusha [124]

Answer: The enthalpy of combustion, per mole, of butane is -2657.4 kJ

Explanation:

The balanced chemical reaction is,

$2C_4H_{10}(g)+13O_2(g)\rightarrow 8CO_2(g)+10H_2O(g)$

The expression for enthalpy change is,

$\Delta H=[n\times H_f_{products}]-[n\times H_f_{reactants}]$

Putting the values we get :

$\Delta H=[8\times H_f_{CO_2}+10\times H_f_{H_2O}]-[2\times H_f_{C_4H_{10}+13\times H_f_{O_2}}]$

$\Delta H=[(8\times -393.5)+(10\times -241.82)]-[(2\times -125.7)+(13\times 0)]$

$\Delta H=-5314.8kJ$

2 moles of butane releases heat = 5314.8 kJ

1 mole of butane release heat = $\frac{5314.8}{2}\times 1=2657.4kJ$

Thus enthalpy of combustion per mole of butane is -2657.4 kJ

3 0

3 years ago

1. Create a diagram of your electroplating apparatus (an electrolytic cell). Then submit your drawing with the following terms l

Anestetic [448]

A picture of the electroplating apparatus can be found attached. The nail (cathode) is completely submerged and that is where reduction happens. In the other side, the copper strip is (anode) where oxidation happens. The electron flow happens from the anode to the cathode. The positive charge of the battery is attached to the anode while the negative side is attached to the cathode.

6 0

3 years ago