1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
2 years ago
11

0.00000000082 - scientific notation

Chemistry
1 answer:
Nadusha1986 [10]2 years ago
6 0

Answer:

8.2 x 106^-11

Explanation:

To begin this problem you must remember the basic rule of scientific notation, which is, must be between 1-10. .000000000082 is much smaller than 1. However by moving the decimal 11 spots to the right, we can make it 8.2

Continue to move the decimal to the right until the value is in the 1-10 range. Make sure to count the moves to the right.

Once the decimal is in the right spot count the spots moved.

Since the number is wayyy smaller than the answer given the number will be negative 10^-11, in order to make it what is was before.

You might be interested in
Use Hess's Law to calculate the enthalpy change for the reaction
Marysya12 [62]

Answer:

ΔH = 125.94kJ

Explanation:

It is possible to make algebraic sum of reactions to obtain ΔH of reactions (Hess's law). In the problem:

1. 2W(s) + 3O2(g) → 2WO3(s) ΔH = -1685.4 kJ

2. 2H2(g) + O2(g) → 2H2O(g) ΔH = -477.84 kJ

-1/2 (1):

WO3(s) → W(s) + 3/2O2(g) ΔH = 842.7kJ

3/2 (2):

3H2(g) + 3/2O2(g) → 3H2O(g) ΔH = -716.76kJ

The sum of  last both reactions:

WO3(s) + 3H2(g) → W(s) + 3H2O(g)

ΔH = 842.7kJ -716.76kJ

<h3>ΔH = 125.94kJ </h3>
3 0
3 years ago
Select the correct terms to complete the statement:
Likurg_2 [28]

Answer:

The particles that make up a substance in its liquid state have <u>more </u>kinetic energy than those of the same substance in its solid-state.

For a solid to melt, energy must be <u>added to</u> the system.

For a liquid to freeze, energy must be <u>removed from</u> the system.

5 0
2 years ago
The seafloor and continental land are similar in age true or false
EastWind [94]

false my dude......;;;;;;;;;;;;;;;[[[[[[

7 0
3 years ago
Determine the concentration of a solution prepared by diluting 20.0 mL of a 0.200 M KCl to 250.0 mL.
My name is Ann [436]

Answer:

ok

Explanation:

5 0
2 years ago
Which operation best represents how to solve for the mass number of an atom?
lina2011 [118]

Answer:

C. protons + neutrons

Explanation:

The mass number is defined as the total number of protons and neutrons in an atom.

6 0
1 year ago
Other questions:
  • Water, air, buildings, food, and everything visible and invisible have mass and takes up space. What is the word used to describ
    7·1 answer
  • What processes occur in a plant leaf?
    14·1 answer
  • PLZ HELP ME. This is my second time posting my question because the first time a person put a random answer. If you do not know
    7·2 answers
  • Select all statements that correctly describe hemoglobin and myoglobin structure. a. Molecular oxygen binds irreversibly to the
    6·1 answer
  • What information does DNA provide to all of the cell's organelles
    5·2 answers
  • Carbon disulfide is formed by the reaction of coke (carbon) with sulfur dioxide. how many moles of cs2 will be generated if 8.0
    5·1 answer
  • Check out this long-form version of the periodic table. It shows where the two rows of
    15·1 answer
  • I will give brainiest how does a orange get its color
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 1 A pump with an 80% efficiency drives water up between two reservoirs through a piping system of total length L = 15 and circul
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!