Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
There is two iron atoms.
Explanation:
The formula iron oxide is Fe2O3 F e 2 O 3 therefore there would be two. Hope this helps. :)
Answer:
The correct answer is because the molecular structure.
Explanation:
The difficulty of ammonia and methane to be represented on paper is due to the molecular structure. These compounds have a three-dimensional projection with defined angles. Ammonia presents angles of 109.5º between the atom of Nitrogen and those of Oxygen. The ammonia presents 107.8º between the oxygen atoms.
In the methane molecule, there is 109.5º between the hydrogen molecules and the carbon atom. This results in the need for a 3D representation of the molecule.
Have a nice day!
