1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
4 years ago
15

You dissolve 4.5 mol of potassium hydroxide to make a 2 L solution. What is the molarity of the solution?

Chemistry
1 answer:
pshichka [43]4 years ago
7 0
Data:
M (molarity) = ? (Mol/L)
m (mass) = ? (in grams)
V (volume) = 2 L 
MM (Molar Mass) of Potassium Hydroxide (KOH)
K = 1*39 = 39 amu
O = 1*16 = 16 amu
H = 1*1 = 1 amu
------------------------------------
MM  of KOH = 39+16+1 = 56 g/mol

***<span>Let's find the mass
</span>Data:
n (number of mols) = 4.5 mols
m (mass) = ? (in grams)
v (volume) = 2 L

Formula:

n =  \frac{m}{V}
4.5 = \frac{m}{2}
m = 4.5*2
\boxed{m = 9.0\:g}

***<span>Let's find the molarity:
</span>
Formula:

M = \frac{m}{MM*V}

Solving:
M = \frac{m}{MM*V}
M = \frac{9.0}{56*2}
M = \frac{9.0}{112}
M = 0.0803...\:\to\:\boxed{\boxed{M \approx 0.08\:Mol/L}}\end{array}}\qquad\quad\checkmark



You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What is the effect on pollution when cool air becomes trapped under warm air?
sergejj [24]
More pollutants accumulate
3 0
3 years ago
Read 2 more answers
I need help on thiss
Sergio039 [100]

The reaction is not balanced

<h3>Further explanation</h3>

Given

Reaction

2Fe(s)+3O₂(g)⇒2Fe₂O₃(s)

Required

The number of atoms

Solution

In a balanced chemical equation, the number of atoms in the compound that reacts (the reactants and products) will have the same number

Reactants : Fe(s)+O₂(g)

Fe = 2 atoms

O = 3 x 2 = 6 atoms

Products : Fe₂O₃(s)

Fe = 2 x 2 = 4 atoms

O = 2 x 3 = 6 atoms

The reaction is not balanced because the number of Fe atoms is not the same

The balanced reaction should be:

4Fe(s)+3O₂(g)⇒2Fe₂O₃(s)

8 0
3 years ago
What is the molarity of a solution of 17.0 g of nh4br in enough h2o to make 158 ml of solution? answer in units of m?
vivado [14]
Unit of M is also mole/L, where mole is the moles of solute and L is the volume of the solution.  The latter is given: 158 mL or 0.158 L.  So we need to find out the moles of NH4Br.

Moles of NH4Br = Mass of NH4Br/molar mass of NH4Br = 17.0g/(14+1*4+79.9)g/mol = 0.1736 mole.

So, the molarity of the solution = 0.1736mole/0.158L = 1.10 mole/L = 1.10 M
6 0
3 years ago
PLEASE HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
iogann1982 [59]

2. is point source

3. is non point source

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which process removes carbon dioxide from the atmosphere
    15·2 answers
  • The symbol for xenon (Xe) would be a part of the noble gas notation for the element antimony. cesium. radium. uranium.
    12·2 answers
  • Which element is a metalloid out of aluminum, arsenic, carbon, and helium?
    13·1 answer
  • How many formula units in MgCl2
    5·2 answers
  • Please help me!! PLEASE
    11·1 answer
  • An object resting on top of a building has the most potential energy ....
    8·2 answers
  • A sample of Xe gas is observed to effuse through a pourous barrier in 4.83 minutes. Under the same conditions, the same number o
    11·1 answer
  • What is the average atomic mass of an element that has 3 isotopes with the data below?
    6·1 answer
  • The density of aluminum is 2.70 g/mL. The volume of a solid piece of aluminum is 1.50 ml. What is its mass?
    8·1 answer
  • Someone people help me with this chemistry question
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!