1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
8

so i am doing a science project and i am doing it on mold i put water on the bread and cheese and left one in the dark and one i

n the light FOR A TWO WEEKS it isnt working why not
Chemistry
1 answer:
ivann1987 [24]3 years ago
3 0

Answer:

because the bread and cheese is absorbing the water whereas if you leave it dry in a moist humid place mold will start to appear

Explanation:

You might be interested in
I need help yall ill mark brainliest :)
garri49 [273]

Answer:

How does non-human life in an urban ecosystem differ from that in an undeveloped forest ecosystem?

Explanation:

In forest eco system the people are uncivilized and not so much educated. And in urban eco system people are intelligent as well as educated this is the main reason. In an urban ecosystem, the only non-human life that live there are the ones that are able to survive under the conditions. However, in undeveloped forest ecosystems, there’s barely any pollution. Therefore, a bigger variety of non-human life is able to live here.

Mark brainliest if you can please :)

3 0
3 years ago
Help me with this question?!!​
olya-2409 [2.1K]

Answer:

500 mL

Explanation:

Step 1: Find conversions

1 mL = 0.0338 oz

Step 2: Use Dimensional Analysis

16.9 \hspace{2} oz(\frac{1 \hspace{2} mL}{0.0338 \hspace{2} oz} ) = 500 mL

3 0
3 years ago
A solution is produced in which water is the solvent and there are four solutes. Which of the solutes can dissolve better if the
djverab [1.8K]

Answer:

What are the solutes

Explanation:

5 0
4 years ago
For the following hypothetical reaction:
olga55 [171]

 The  moles  of  B that  will be  needed  to convert 2 moles of A into  as many moles of C as possible   is   6 moles


Explanation

 3A +9B → 5C

The  moles of B  are  calculated using the mole  ratio.

That is;  from the equation above the  mole ratio   of A:B  is  3:9  

If the moles of A required is 2 moles therefore the moles of B

= 2 x9/3= 6  moles

3 0
3 years ago
How many different kinds of monomers are there in nucleic acids?
Oxana [17]
<em>Kinds of monomers in nucleic acids:</em>
<em>There are 5 types of monomers in nucleic acids they are called nucleutides. </em><span><em>The five pieces are</em><em> uracil</em><em>, </em><em>cytosine</em><em>, </em><em>thymine</em><em>, </em><em>adenine</em><em>, and</em><em>guanine</em><em>.</em></span>
8 0
3 years ago
Other questions:
  • (b) what is the major product of the reaction at very low temperatures?
    6·1 answer
  • Which of the compounds, C3H8, mgcl2, OCl2 are expected to exist as molecular compounds?
    11·1 answer
  • 4. Why can't the subscripts be changed in a chemical equation in chemistry
    13·1 answer
  • Foods rich in simple carbohydrates or starch but low in fat or fiber tend to
    10·2 answers
  • Express 410,000 in scientific notation
    5·1 answer
  • 3. Determine the pH of each of the following solutions. (Hint: See Sample Problem B.) a. 1.0 x 10-2 M HCI c. 1.0 x 10-MHI b. 1.0
    7·1 answer
  • Which of the following latitudes receive the most direct solar energy?
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What two particles make up the mass number?
    12·1 answer
  • A heterogeneous material may be
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!