1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
4 years ago
15

Benzoic acid, c6h5cooh, has a ka = 6.4 x 10-5. what is the concentration of h3o+ in a 0.5 m solution of benzoic acid? 3.2 x 10-5

m
Chemistry
1 answer:
FinnZ [79.3K]4 years ago
3 0
The answer for this issue is: 
The chemical equation is: HBz + H2O <- - > H3O+ + Bz- 
Ka = 6.4X10^-5 = [H3O+][Bz-]/[HBz] 
Let x = [H3O+] = [Bz-], and [HBz] = 0.5 - x. 
Accept that x is little contrasted with 0.5 M. At that point, 
Ka = 6.4X10^-5 = x^2/0.5 
x = [H3O+] = 5.6X10^-3 M 
pH = 2.25
(x is without a doubt little contrasted with 0.5, so the presumption above was OK to make) 
You might be interested in
Define international system of units , where does the system originate
BARSIC [14]

Answer:

The International System of Units (SI) is originated in France by frenches and originally was called a metric system of measurements. It provides definitions of various units of measurement such as weight, distance, electric current, temperature, and others which is widely accepted in the different fields of science and technology.

It is the system that is extended and derived from the french metric system of measurement is accepted in 1960 by convention 44 nation of the world to use particular unit of measurement worldwide to avoid confusion.

6 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which state of matter has the least energetic molecules?
SVEN [57.7K]
Solids have least energetic molecules because they are tightly packed.
5 0
3 years ago
Which best describes the process that occurs when liquid water becomes<br> ice?
garri49 [273]

Answer:

Freezing

Explanation:

When a liquid goes to a solid, this process is called freezing.

7 0
3 years ago
Read 2 more answers
Hands moving on a battery-operated clock is an example of what kind of
Alexxandr [17]
The C is right answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which stage of the cell involves cell growth and DNA replication?
    7·2 answers
  • The density of human blood is 1.06g/ml the volume is 5.5l what is the mass in kg
    10·1 answer
  • A type of wood known as white pine has a density equal to 0.50 g/cm. What is the mass of a block of white pine that has the dime
    12·1 answer
  • Which of phase changes requires an input of energy
    12·1 answer
  • What are the classification of most of the elements described as?
    13·2 answers
  • Note that butane has two possible isomers but that decane has 75 possible isomers. Why does the number of possible isomers go up
    6·1 answer
  • What is the formula for this ionic compound and tha name ?
    15·1 answer
  • Which of these best describes the role of plants in the carbon-oxygen cycle? A. to absorb carbon dioxide from the atmosphere and
    5·2 answers
  • Using bond energies, estimate the enthalpy of reaction for the following chemical reaction. CH4(g) + 4 F2(g) → CF4(g) + 4 HF(g)
    6·1 answer
  • Reflection obtained from a smooth surface is called a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!