Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
<span>Ethoxyethane; trifluoroborane; BF3.Et2O; Boron trifluoride ethyl ether; Boron trifluoride diethyl ether; Boron trifluoride-diethyl ether; Boron
</span>
So the answer is Jesus I hope this helps on your test or quiz! ☮️ peace ☮️
Answer:
water cycle and carbon cycle
Answer:
Outer planets are significantly colder than other planets! The answer is B.
Explanation:
The main difference between inner and outer planets is that inner planets have a high temperature compared to outer planets.
