1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
9

a block of wood has a density of 0.95 g/cm3. will it float or sink when placed on a liquid with a density of 0.88 g/mL? explain

your answer.
Chemistry
2 answers:
Lynna [10]3 years ago
8 0

Answer : The block of wood will sink.

Explanation :

As we given that:

The density of block of wood = 0.95g/cm^3=0.95g/mL

The density of liquid = 0.88 g/mL

  • When the density of a substance will be greater than the density of medium then the substance will sink.
  • When the density of a substance will be lesser than the density of medium then the substance will float.

As per question we conclude that,

The density of substance (wood) is greater than the density of medium (liquid). That means, the block of wood will sink.

Hence, the block of wood will sink.

vesna_86 [32]3 years ago
3 0
Since 1mL=1cm^3 the wood would sink due to it being more dense. I.e. 0.95>0.88
You might be interested in
There have been different models of the atom over time. How has the competition between these models affected our understanding
lions [1.4K]
Doing the same final thanks 
6 0
4 years ago
Read 2 more answers
What is the missing value​
Korvikt [17]

Answer:

72

Explanation:

The pattern here may be hard to find at first, but it's this: the number in the middle of the triangle = (number at lower left corner of triangle x number at upper vertex of triangle) + (number at upper vertex of triangle x number at lower right corner of triangle).

Thus, for the missing value...

Missing value = (3x8) + (8x6) = 24+48 = 72.

Could you tell me what concept in chemistry relates to this? I'm interested.

Also check out stylesben's answer. Seems like there's several ways of doing this.

7 0
3 years ago
Read 2 more answers
Which of the following describes a perpetual-motion machine?
makkiz [27]

Answer:

a motor that requires no energy input once it is running

5 0
3 years ago
Read 2 more answers
3 points
vfiekz [6]

Answer:

density=6.74g/ml

:320g÷47.5ml

d=6.74g/ml

thank you

<em><u>I </u></em><em><u>hope</u></em><em><u> </u></em><em><u>this </u></em><em><u>is </u></em><em><u>helpful</u></em>

8 0
3 years ago
What problem can fossil fuel create for life on earth?
Darya [45]
Pollution and rising temperatures
4 0
3 years ago
Other questions:
  • I need to know the answers
    13·1 answer
  • What mass of water must be added to 5g of nacl to make 5% mass persentage of the solution?
    6·1 answer
  • Please help me answer all of these questions! Will give brainliest answer and a heart (probably 5 stars) please and thank you. h
    13·1 answer
  • A sample of i-131 decays from 12 microcuries to 3.0 microcuries in 16 days. what is the half-life of i-131?
    11·1 answer
  • How many grams of Ca metal are produced by the electrolysis of molten CaBr2 using a current of 30.0 amp for
    11·1 answer
  • Chlorite anion was exposed to strong radiation and had 2 successive electrons removed, creating a chlorite cation. What is the m
    8·1 answer
  • 3. Which best describes the definition for the atomic mass of an element?
    13·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What type of chemical reaction is the following:<br><br> Ag2O ➜Ag + O2
    15·1 answer
  • Calculate 5.1234 + 0.033÷ 1.650 and report to the correct number of significant figures.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!