1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
6

When 0.2 kg of gasoline undergoes combustion, 18500 kJ of energy are released. Express the heat released, 18500 kJ in calories.

(Given 4.184 J = 1 cal)
Chemistry
1 answer:
mezya [45]3 years ago
5 0
The problem above is simply asking to convert one unit of energy to another of unit energy. We convert measurements by multiplying conversion factors. The conversion factor, for this case, is 1 cal / 4.184 kJ. We multiply this value to the measurement.

18500 kJ (1/4.184) = 4421.61 calories
You might be interested in
Which of the following is not a postulate of the kinetic molecular theory?
tester [92]

Explanation:

Which of the following is not a postulate of the kinetic molecular theory?

Answer is

option D. the collisions between gas molecules are elastic

<em>Hope</em><em> </em><em>it</em><em> </em><em>will</em><em> </em><em>help</em><em> </em><em>you</em>

6 0
3 years ago
Ayudaaaaaa!!!!!!!!!!!!!!!!!!
Eva8 [605]

Answer:

uh you good

Explanation:

4 0
2 years ago
NEED HELP! what is a orbital . describe
olchik [2.2K]

Answer:

In chemistry and quantum mechanics, an orbital is a mathematical function that describes the wave-like behavior of an electron, electron pair, or (less commonly) nucleons. An orbital can contain two electrons with paired spins and is often associated with a specific region of an atom.

Explanation:

6 0
3 years ago
How many molecules are in 0.500 mole of N2O5?
Oksi-84 [34.3K]

Answer:

3,011.10e23.

Explanation:

3 0
2 years ago
A concentration cell consists of two zn/zn2+ electrodes. the electrolyte in compartment a is 0.10 m zn(no3)2 and in compartment
Dmitrij [34]

Answer:

E= -0.023V

Explanation:

find the solution below

7 0
3 years ago
Other questions:
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Determine the empirical formula for c6n4o10
    11·1 answer
  • I need answers for this question.
    7·1 answer
  • Find the Ka of nitrous acid given that a 0.20 M solution of the acid has a hydrogen ion concentration of 2.8*10-3 M. HNO2 (aq) ?
    14·1 answer
  • How does the tilt of earth <br>affect the climate?
    15·1 answer
  • What is whether? what is climate? Does todays weather impact climate?​
    9·1 answer
  • Is this right??? If not gimme da right answer plz
    7·2 answers
  • Laura jala un trineo una distancia de 2000 cm usando una cuerda, con una tensión constante de 80 N. La tarea requiere de 800 J d
    14·1 answer
  • I’m completely lost on these stoichiometry problems
    7·2 answers
  • How many protons are in Calcium - 41?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!