1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
3 years ago
7

The formula for ammonium carbonate:

Chemistry
1 answer:
Dima020 [189]3 years ago
6 0

Ammonium is NH₄⁺ and Carbonate is CO₃⁻² => Ammonium Carbonate is (NH₄)₂CO₃

You might be interested in
What is the product of the reaction of an alcohol and a carboxylic acid when heated together
natulia [17]

Answer:

Explanation:

The direct reaction of a carboxylic acid with an amine would be expected to be difficult because the basic amine would deprotonate the carboxylic acid to form a highly unreactive carboxylate. However when the ammonium carboxylate salt is heated to a temperature above 100 C water is driven off and an amide is formed.

5 0
2 years ago
Nuclear energy could come from
lianna [129]
Nuclear energy comes from splitting of Barium atom to form Krypton atom
5 0
3 years ago
How are molecules built?
RoseWind [281]
Bonding I'm guessing
6 0
2 years ago
Heat is transferred by conduction through a wall of thickness 0.87 m. What is the rate of heat transfer if the walls thermal con
erik [133]

Explanation:

The given data is as follows.

         Thickness (dx) = 0.87 m,       thermal conductivity (k) = 13 W/m-K

        Surface area (A) = 5 m^{2},       T_{1} = 14^{o}C

        T_{2} = 93^{o}C

According to Fourier's law,

                    Q = -kA \frac{dT}{dx}

Hence, putting the given values into the above formula as follows.

                      Q = -kA \frac{dT}{dx}

                          = -13 W/m-k \times 5 m^{2} \times \frac{(14 - 93)}{0.87 m}

                          = 5902.298 W

Therefore, we can conclude that the rate of heat transfer is 5902.298 W.

4 0
3 years ago
List all wether
nignag [31]

Explanation:

Agricultural productivity is dependent on Co2, Temperature, Solar Radiation, Precipitation, Soil Moisture and Wind Direction. Changes in any or all of these elements has a direct impact on the crop production.

7 0
2 years ago
Other questions:
  • Which term labels a solution
    12·1 answer
  • NOT A SERIOUS QUESTION IM JUST EXPLORING BRAINLY.COM!!
    12·1 answer
  • Can somebody Answer number 23 please it’s for a exam
    15·1 answer
  • Which is most likely why many scientists reject the cold fusion theory?
    15·1 answer
  • If you wanted to measure in irregular object's volume, which device would you use?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The wavelength of some violet light is 420.0 nm. What is the frequency of this violet light?
    12·1 answer
  • Calculate the pH of a solution containing a caffeine concentration of 455 mg/L . Express your answer to one decimal place.
    14·1 answer
  • PLS HELPPP How many moles of oxygen atoms (not molecules) are present in 6.41×1025 molecules of dinitrogen pentoxide (N2O5)? 1.
    14·1 answer
  • 1.00 mL of a 3.05 × 10–4 M solution of oleic acid is diluted with 9.00 mL of petroleum ether,
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!