Answer: 11.2 L of 
at 273K and 202kPa
Explanation:
According to ideal gas equation:
P = pressure of gas = 202 kPa = 1.99 atm ( 1kPa= 0.0098 atm)
V = Volume of gas = 11.2 L
n = number of moles = ?
R = gas constant =
T =temperature =
According to avogadro's law, equal number of moles occupy equal volumes and contain equal number of molecules at same temperature and pressure conditions.
As 11.2 L of at 273K and 202kPa will have same moles as 11.2L of He (g) at 273K and 202kPa, thus they have same number of molecules.
Well, you just have to look for the one that does not have any positive/benefit.
1. is not the answer, since vaccines prevent countless people from disease and death.
2. is not the answer since animal abuse is not okay and the statement shows that science has become more efficient, therefore helping society become more efficient
3. is definitely not a positive effect that biotech has had on society. antibiotic-resistant bacteria endangers everyone. Therefore, this is the answer :)
4. is not the answer because helping people with diabetes be able to afford their medication is very helpful.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Atoms consist of three basic particles: protons, electrons, and neutrons. The nucleus (center) of the atom contains the protons (positively charged) and the neutrons (no charge). The outermost regions of the atom are called electron shells and contain the electrons (negatively charged).
Explanation:
