1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
12

Alicia purchased a $1,000 bond with a maturity of 20 years. since she bought it, the rate of interest paid by other, slimier bon

ds with the maturity of her bond have gone up substantially. how much could Alicia get for her bond if she sells it now, before it matures?
a) less then $1,000
b) no bonds may be sold before maturity
c) more than $1,000
d) $1,000
Mathematics
1 answer:
Allisa [31]3 years ago
7 0
The answer would be A) less than 1,000 Dollars
You might be interested in
What are the values of m and 0 in the diagram below?
Sliva [168]

Answer:

<h3>The correct answer is</h3>

hope it helps

3 0
3 years ago
How do you calculate 1/5
bonufazy [111]

Answer:

0.2

Step-by-step explanation:

I hope this helps you enough.

4 0
2 years ago
Select ALL the correct answers.
jolli1 [7]

Answer:

(4x+5)(-3x-1) = -12x²-19x-5

Option A:

   (-16x² + 10x - 3) + (4x² - 29x - 2) = -12x²-19x-5

   Option A is correct.

Option B:

   3(x - 5) - 2(6x² + 9x + 5) = -12x²-15x-25

   Option B is wrong.

Option C:

   2(x - 1) - 3(4x² + 7x + 1) = -12x²-19x-5

   Option C is correct.

Option D:

   (2x² - 11x - 9) - (14x² + 8x - 4) = -12x²-19x-5

   Option D is correct.

4 0
3 years ago
During a sale a dress decreased in price from $80 to $76 what was the percent of decrease
Nesterboy [21]
<span>Well 68/80 as a percent is 85 % .I got that by dividing 68 by 80 and them multiplying by 100. 100-85= 15. So therefore the dress decreased in price by 15%. </span>
4 0
3 years ago
Which type of graph shows data points plotted and connected by line segments?
faust18 [17]

Answer:

D. a line graph

Step-by-step explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • A round patio is 14 m in diameter. what is the distance around the patio
    13·2 answers
  • PLEASE HELP !! (1/5) - 50 POINTS - no wrong answers please. A) y = 6x - <img src="https://tex.z-dn.net/?f=%5Cfrac%7B11%7D%7B8%7D
    12·1 answer
  • 2^4. 2^5-(2^2)^2 <br> Simplify the expression
    8·1 answer
  • Question 7
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • For what period of time during the dive is the diver's center of mass higher than the diving board, which is 6 feet above the wa
    5·1 answer
  • Simplify the expression . <br><br> A. <br> B. r−1s4<br> C. r−5s4<br> D.
    8·2 answers
  • Please help i don’t really understand it
    13·1 answer
  • Find the area of the circle shown below if the diameter is 24 inches. Use 3.14 for π. Use the formula π x r^2
    7·2 answers
  • A=? Please help as fast as possible!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!